Gene GCA Variant 1
DNA : 16.98 KbNT_005403
mRNA : 1639 bp NM_012198
CDS : 654 bp NP_036330
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  136 bp
ggctcccgatggggtgtagccaatcagggcagagatgggtggggctaggctgcgggaagg
ggcggactgcagctgagttggctccaaagtgtgggactcagccaatcggaaccgtgcagg
gcggggctggcctgcggaagggggcgggttcggaggagtgaactgtgcggttagtgcgcc
TTTCAGCCTCACCTGCAGCTGCGCCTCCTTGCACCTGCGCCTGTGCTTTTTCTCCCAGCA
CTGCGGACGCGACTCGAGGGTGACGCTCGCTCCGCTCGTCCCGCTCGTCATGGCCTACCC
GGGATACGGAGGAGGG
gtgagtcccagccgcttggtcgtgtccctcttcctcgcggggtgtggcgcccccgggggc
ggtgccaacgtgcgggtccgcccttggctcctgctccctgcgtccgcgcctggtactcgg
cggcgccggattccggggctgttgggggccagggcctgggcgagcattgatcctgggctg
EXON 2  165 bp
ttgaattatgtcttaatgtaggacatctaacattttgtagttaaaatttttgtgataaga
ttataagcttttggtaactgtttactttttgacggacttctaataatttcttttaatcca
actttcatagataataggtagtatttatattactaaccttctcccctttcactattatag
TTTGGAAATTTTAGCATTCAGGTGCCAGGAATGCAGATGGGACAGCCAGTGCCAGAAACA
GGCCCAGCTATACTCCTCGATGGATACTCTGGGCCAGCATATTCAGACACTTATTCCTCA
GCTGGTGACTCCGTGTATACTTACTTCAGTGCTGTTGCTGGACAG
gtgagatgctaaatttattgcataaatatgtctttaaaattattgtttaagagaaatgtc
agctatttagagtatcattttaaatgtatatgaaatttatattttatatgtatctagact
aatttttttcctgagatcagagatgagcatagtcataattatttcattttaaaagtctgt
EXON 3  70 bp
ggtatgatattttgtaatatgcctttgttgtcagtaattatctctagaattttgtagtta
attatagagtaatgtttcaaagaatgcatatgtcttgattggcctagaacagtcaattga
cattttaatatgcttttatacaactgcacattaaattaggtcataattatttttaaacag
GATGGTGAAGTGGATGCTGAAGAACTTCAGAGATGTTTGACACAGTCTGGAATTAATGGA
ACTTACTCTC
gtgagatcttttttccccttttgttgaaattataataggaagtttattttcttacttttt
ttgtccctgtaattaaaatgtttaaaaaattatcacagttatacatgcacatagtttaag
gagtcaaataactgtaaaactcgttatgaaaataactgttcattgtgtattcctgtctcc
EXON 4  44 bp
tgaaggcagtaattttttttaaacaatgggtgcttaacattcaataatagcttgttgatt
gtggtgattttatatattttggcagttttttaatgttttattttgaaactggagattgtc
ataattttacatagataaagttgggcatactctaatttaaatattgaatatgttttacag
CCTTCAGTTTGGAAACCTGCAGAATTATGATTGCCATGTTGGAT
gtatccttgaatagaaatagaaaatactagaataaagagtaattgctttctgactatcaa
gccagtggttagatttcagtgcctgtagtaaactagtgaatttaaaaatactttgtaaga
tcctgtttaaattctaggctttctagtttttatgcagaagtctgttcatataatgagttt
EXON 5  148 bp
tgaatttaaaaatactttgtaagatcctgtttaaattctaggctttctagtttttatgca
gaagtctgttcatataatgagtttggctaagtctacagaagcatactcatgttttagtca
atgatttagagtcagataaactcaggtatcagaatttatttttgttaataaaactatcag
AGAGATCACACAGGAAAAATGGGATTTAATGCATTCAAAGAGCTATGGGCAGCTCTTAAT
GCCTGGAAGGAAAACTTCATGACTGTTGATCAAGATGGAAGTGGCACAGTAGAACATCAT
GAGTTGCGTCAAGCCATTGGTCTTATGG
gtaagaacattaacattctttagaatctataaagctaatctttgttctttgattagatga
acttaattgcttcaatttactaactaataaagggatgtatttttttgccagcaagttcct
ttgtttgttttcaaggttgtaggtaaattctgaccaaagacctcaacaaaaccattttaa
EXON 6  114 bp
cgattaacaggattaacagtgaagcctttgtctgatgaatttcaatattcatgtgttttg
tttctaattatatttttgtggaatgaattttgaaagttattttatgacttaatgagaaag
caatcttgcagtgttcttatgttatttacatttagaagttttaatttatctcttttttag
GTTATAGGTTGAGTCCTCAAACATTAACTACTATTGTTAAACGTTATAGCAAGAATGGCA
GAATTTTCTTTGATGATTATGTTGCTTGCTGTGTGAAGCTTCGAGCATTGACAG
gtattgactatttaaaactaagtgcacagtgttatgtagctatttttcttgaataatgtg
tctcatttcctccagcaagtttataataatatgtgttttctccctttattcactgttaaa
tctaattagtttaaaggcttcaaatattaaggaatataaatgataaaaacgttatgttat
EXON 7  59 bp
taaatgataaaaacgttatgttatttttggaagtttttctcatatctctgttgccagggc
tattcaatcacttaatatttaattgaatatgaaattattctttttgtgtacctgggtgca
ctaaatatttgaaactatgtattttaaattacaataaaaaagtaatttctttgtttaaag
ATTTCTTTAGGAAAAGAGACCACTTGCAACAAGGGTCTGCGAATTTCATATATGACGAT
gtgagtatcctgcttttgatatttatactgcattctagatagttctcagttagtaaaaaa
atttaagtgatcccaagtaccagtactggaaataatatatttggtatgccacatactttt
ccatatttttcagtgtaacacaaatataagattaatattggtataggtgccaaacaattt
EXON 8  903 bp
tttcttatatttactgatggaagttatggggtcaacattactgatatttattggcttgaa
ttataagccttggaaacaaacttttctctcttaagaaaatgctcttatggaatataatta
gtcaaaaataattaaaaaccattttattcttaatagataataatttcacttatgtattag
TTTTTGCAGGGCACTATGGCAATTTGAATGCTTAGAATTTTAAACCTGAAGAGACACTGT
GAATTCTTTTGTTTGGAAGAAGTGAACTGGACTACTTTAAAACTTTTAAGGGTTTTCTAT
GTTCTTCCTACCTGTTAAACCTCTTCCCTTTCTGTGTGTTTTTATTTTAGCAGATAGTTC
AAAGCAATAAAAGATTTCTTTTTTAATTTGAGGTATTACTGCTTTTGGAAAAGTTATTTT
ATAAATATGTGCATATTGTCATAAAATATTGTATGATTAATTGATTTAAATAATGCTTAG
CCTTAATTTTAGATAATGTAAATTTAGAGGAATGTACTTTACAAGATAGATTGTATAAGA
AGCCAAATAATGAAAGCCTAGAAAAAACTAATTTATACTTATCTGAAGGTTACAAATTAG
ACTTTTAAATTTTCTTTGTAGTTGGTGGTGTTTGAGGGTTGGCTAGAAATGAAAGCCTGG
ATTTTGTGCCATGTTTGTAATATAGTTTGTTCCTTGATCAAATAATCAGAGAAAAGAAAC
TTAAAGATCTTTGTCTGTGAAGAAGAAAATTATCTCCCTAGTTCAATCTGTAGTGAAATA
AGACTACAGAAGGCATTGTTTTTTCCTTTTTTATTTTTTGTATTATATATTTTTCTTAAA
TATGTTTTATTGTCTTCTCTAAGCAAAAAGTTCTTAATAAACATAGTATTTCTCTCTGCG
TCCTATTTCATTAGTGAAGACATAGTTCACCTAAAATGGCATCCTGCTCTGAATCTAGAC
TTTTTAGAAATGGCATATGTTTTTGATGATATGTCAACATTCAAAATTGTCCTAATTAAA
TTGTTGTTTAAATGTAATGTCAACTCTTTATAAACTTAAAAATAAACAAGTAATTAACCA
CTC
taattgttcagaaattttacatttgacttatttgacaacattaacattagtggtggcttt
gccattaaaaacccagtaagtattttgagtgcatctatgtgatgtggtgttttgagcata
gtaggcaccacagcaacttttctgcgtggtactaaaactgccgaaaatgcgacgtagaat