Gene GAD1 Variant 2
DNA : 24.17 KbNT_005403
mRNA : 828 bp NM_013445
CDS : 675 bp NP_038473
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  82 bp
tcttgtctctccagagccggatcttcaaggggagcctccgtgcccccggctgctcagtcc
ctccggtgtgcaggaccccggaagtcctccccgcacagctctcgcttctctttgcagcct
gtttctgcgccggaccagtcgaggactctggacagtagaggccccgggacgaccgagctg
ATGGCGTCTTCGACCCCATCTTCGTCCGCAACCTCCTCGAACGCGGGAGCGGACCCCAAT
ACCACTAACCTGCGCCCCACAA
gtaggtcccgccccaattttctatcaaatgaactgcagggaagatgggggcgctgggacg
tcgggaggctgagctggcggaaagggaagggggagcgcggagataatggaggctgggaaa
taaatggggctctgaccccgtccctgccagaggtcattcggctgtcagggacgctaggtg
EXON 2  63 bp
ggcttagagtatatgcctgtcggctcacagatttggctcctagctcctttcaggaagtag
cttttaatgaagagctctggcaaagtcctcatcctcccccaagaaaaccattgtcctcca
cccatttccccgcggtcggaacctccctaaccgaacctctctccctctctctcgtcctag
CGTACGATACCTGGTGCGGCGTGGCCCATGGATGCACCAGAAAACTGGGGCTCAAGATCT
GCG
gtaagtgacaggacccactggggcccggctgggtggcgcggcgggcggacctttggggct
tgggagactgggacgcaagcggagggggatccgggctcatgggtctgattttctaatgta
attacagccaggacagccagcgaccacgctcccctacaggccctgaccctcctctgcccg
EXON 3  159 bp
ctgcccccctccctgcctgaaggcgagcagtgccagagccactgtatttaaaacacagac
actcacttcttttctcaggagaaacaagagccctgcttggagagttgattcactctgcag
ctgaccctcaggggctgggcagtttgcagcactctctctgaccagcttcttgtgccatag
GCTTCTTGCAAAGGACCAACAGCCTGGAAGAGAAGAGTCGCCTTGTGAGTGCCTTCAAGG
AGAGGCAATCCTCCAAGAACCTGCTTTCCTGTGAAAACAGCGACCGGGATGCCCGCTTCC
GGCGCACAGAGACTGACTTCTCTAATCTGTTTGCTAGAG
gtagcccctgccccactcccgccccatgctagccagtagatttcttatttgagtttcttg
actttttcctgcaattttacttcttttatcaagaaatgtcattattctctctgaacccac
atgaaactgcttttgtgactttgggggaatataattgactccctccctccctgctggcca
EXON 4  243 bp
caaaacttctgtgtatgtgcatttttctggagatgtggtatatccgattctcagtgcaca
tacatatcccagaatgaaatcaggcctatacagatagcatggttaatattaggggtctct
gggctgaagaaatctagatatgagtcaggtgaaaaccattcattgctctccccaattcag
ATCTGCTTCCGGCTAAGAACGGTGAGGAGCAAACCGTGCAATTCCTCCTGGAAGTGGTGG
ACATACTCCTCAACTATGTCCGCAAGACATTTGATCGCTCCACCAAGGTGCTGGACTTTC
ATCACCCACACCAGTTGCTGGAAGGCATGGAGGGCTTCAACTTGGAGCTCTCTGACCACC
CCGAGTCCCTGGAGCAGATCCTGGTTGACTGCAGAGACACCTTGAAGTATGGGGTTCGCA
CAG
gtaaggaggagagttgggtagacaggtagtggcaactttgccctccatctcacccttgcc
agttgtgaggatatcaaacttgtgttggaagaaaaacacagccctggtgagataaggcgg
caaagtacccagtgaccacaagaacaagcttgggcagtaacagttggtggagggacccga
EXON 5  91 bp
ttaatgttggtatagggtgggtcaacctgcccttcctttttcaatatccttgagcagcct
tattcgacatatcactgggatggaagccccatcagtgtgacccagtggggcaggccgttt
gccttcaagataggttgagaaatctgcatttgccttgatgcttttctgtttcctatctag
GTCATCCTCGATTTTTCAACCAGCTCTCCACTGGATTGGATATTATTGGCCTAGCTGGAG
AATGGCTGACATCAACGGCCAATACCAACAT
gtaagtctcatatgttttcatataagcaaccctgatgtatgactatggcttgttgcttta
aaagttcagtcccagtggttctattttattaaagtttccctggtcattttttctcttaaa
atctttaggtttatcacagttctgatttaatggtaaatacttgataaactattgttgaat
EXON 6  190 bp
gccaccagtatctcctcgccatgcaaacatttttgtcatgtcaacatttccaaaaaccag
tggaaccattaataacacatttgttcaagaatggttaaaagcccatcatgagtttgcctc
ttggtacacttggcagcacaggctaaaccaggaatccttctcttcttcttcctttatcag
GCCATCAGACATGAGGGAGTGTTGGTTGCTACGGTGATGGGGCTCAGAGCAGAACCAAAG
CATGATTGTGACCTCCAGAGGTGATGGTAACTGCACACATGGTTTCCAAGGGTCTTCCTC
CTAAATTTCCAGGGGCCTCCCAAGGAAAATGGACATATTCTTTTTGGAAATAAAATACTT
CTACCAACAT
atctgaggatccttcaggatctttttgtcttcttttacctccatgtgattaatttgactg
cttttttcatccacaattaaaacttagtagcttcacctgtgtcttatgtaaaacaatagt
tatctcatccttacaaatagctttgccttacattaagcaagcaagaattcccattagtct