Gene GAD1 Variant 1
DNA : 44.58 KbNT_005403
mRNA : 3592 bp NM_000817
CDS : 1785 bp NP_000808
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  487 bp
gaggacacgacccaaagcgcgctttcgctcaaggaagcgtcgcagggtcacagatctggg
ggaaccccggggaaaagcactgaggcaaaaccgccgctcgtctcctacaatatatgggag
ggggaggggaaatgggagaggggaaaggaggggagggaagaagaaacgctcagaaaggca
GAATTCTTCGTAGGAATTATCTTTTCCCTCCTCTCACCCGACAGCCTGCCTATTTCCAAA
GGAAAAAAAAAAAGCGTGTTGAGTACGTTCTGGATTACTCATAAGACCTTTTTTTTTTCC
TTCCGGGCGCAAAACCGTGAGCTGGATTTATAATCGCCCTATAAAGCTCCAGAGGCGGTC
AGGCACCTGCAGAGGAGCCCCGCCGCTCCGCCGACTAGCTGCCCCCGCGAGCAACGGCCT
CGTGATTTCCCCGCCGATCCGGTCCCCGCCTCCCCACTCTGCCCCCGCCTACCCCGGAGC
CGTGCAGCCGCCTCTCCGAATCTCTCTCTTCTCCTGGCGCTCGCGTGCGAGAGGGAACTA
GCGAGAACGAGGAAGCAGCTGGAGGTGACGCCGGGCAGATTACGCCTGTCAGGGCCGAGC
CGAGCGGATCGCTGGGCGCTGTGCAGAGGAAAGGCGGGAGTGCCCGGCTCGCTGTCGCAG
AGCCGAG
gtgggtaagctagcgaccacctggacttcccagcgcccaaccgtggcttttcagccaggt
cctctcctcccgcggcttctcaaccaaccccatcccagcgccggccacccaacctcccga
aatgagtgcttcctgcccgccctagtccctgctctccacgggtgcgctgcgcagggaccc
EXON 2  145 bp
cgtctcctccgctgcccccacccctgcgcacccctaccaggcaggctcgctgcctttcct
ccctcttgtctctccagagccggatcttcaaggggagcctccgtgcccccggctgctcag
tccctccggtgtgcaggaccccggaagtcctccccgcacagctctcgcttctctttgcag
CCTGTTTCTGCGCCGGACCAGTCGAGGACTCTGGACAGTAGAGGCCCCGGGACGACCGAG
CTGATGGCGTCTTCGACCCCATCTTCGTCCGCAACCTCCTCGAACGCGGGAGCGGACCCC
AATACCACTAACCTGCGCCCCACAA
gtaggtcccgccccaattttctatcaaatgaactgcagggaagatgggggcgctgggacg
tcgggaggctgagctggcggaaagggaagggggagcgcggagataatggaggctgggaaa
taaatggggctctgaccccgtccctgccagaggtcattcggctgtcagggacgctaggtg
EXON 3  63 bp
ggcttagagtatatgcctgtcggctcacagatttggctcctagctcctttcaggaagtag
cttttaatgaagagctctggcaaagtcctcatcctcccccaagaaaaccattgtcctcca
cccatttccccgcggtcggaacctccctaaccgaacctctctccctctctctcgtcctag
CGTACGATACCTGGTGCGGCGTGGCCCATGGATGCACCAGAAAACTGGGGCTCAAGATCT
GCG
gtaagtgacaggacccactggggcccggctgggtggcgcggcgggcggacctttggggct
tgggagactgggacgcaagcggagggggatccgggctcatgggtctgattttctaatgta
attacagccaggacagccagcgaccacgctcccctacaggccctgaccctcctctgcccg
EXON 4  159 bp
ctgcccccctccctgcctgaaggcgagcagtgccagagccactgtatttaaaacacagac
actcacttcttttctcaggagaaacaagagccctgcttggagagttgattcactctgcag
ctgaccctcaggggctgggcagtttgcagcactctctctgaccagcttcttgtgccatag
GCTTCTTGCAAAGGACCAACAGCCTGGAAGAGAAGAGTCGCCTTGTGAGTGCCTTCAAGG
AGAGGCAATCCTCCAAGAACCTGCTTTCCTGTGAAAACAGCGACCGGGATGCCCGCTTCC
GGCGCACAGAGACTGACTTCTCTAATCTGTTTGCTAGAG
gtagcccctgccccactcccgccccatgctagccagtagatttcttatttgagtttcttg
actttttcctgcaattttacttcttttatcaagaaatgtcattattctctctgaacccac
atgaaactgcttttgtgactttgggggaatataattgactccctccctccctgctggcca
EXON 5  243 bp
caaaacttctgtgtatgtgcatttttctggagatgtggtatatccgattctcagtgcaca
tacatatcccagaatgaaatcaggcctatacagatagcatggttaatattaggggtctct
gggctgaagaaatctagatatgagtcaggtgaaaaccattcattgctctccccaattcag
ATCTGCTTCCGGCTAAGAACGGTGAGGAGCAAACCGTGCAATTCCTCCTGGAAGTGGTGG
ACATACTCCTCAACTATGTCCGCAAGACATTTGATCGCTCCACCAAGGTGCTGGACTTTC
ATCACCCACACCAGTTGCTGGAAGGCATGGAGGGCTTCAACTTGGAGCTCTCTGACCACC
CCGAGTCCCTGGAGCAGATCCTGGTTGACTGCAGAGACACCTTGAAGTATGGGGTTCGCA
CAG
gtaaggaggagagttgggtagacaggtagtggcaactttgccctccatctcacccttgcc
agttgtgaggatatcaaacttgtgttggaagaaaaacacagccctggtgagataaggcgg
caaagtacccagtgaccacaagaacaagcttgggcagtaacagttggtggagggacccga
EXON 6  91 bp
ttaatgttggtatagggtgggtcaacctgcccttcctttttcaatatccttgagcagcct
tattcgacatatcactgggatggaagccccatcagtgtgacccagtggggcaggccgttt
gccttcaagataggttgagaaatctgcatttgccttgatgcttttctgtttcctatctag
GTCATCCTCGATTTTTCAACCAGCTCTCCACTGGATTGGATATTATTGGCCTAGCTGGAG
AATGGCTGACATCAACGGCCAATACCAACAT
gtaagtctcatatgttttcatataagcaaccctgatgtatgactatggcttgttgcttta
aaagttcagtcccagtggttctattttattaaagtttccctggtcattttttctcttaaa
atctttaggtttatcacagttctgatttaatggtaaatacttgataaactattgttgaat
EXON 7  113 bp
ggtttctgacattttatgatcggcgacttaatgcatttccaggaaatgaatcatgttagt
ggtttggaacagcttttttttagaacccaactacaaatactaaaccaatcctctgtgttc
ctaaaataagtggtttgacttctttattttctttcatccttcttcttaccacctttccag
GTTTACATATGAAATTGCACCAGTGTTTGTCCTCATGGAACAAATAACACTTAAGAAGAT
GAGAGAGATAGTTGGATGGTCAAGTAAAGATGGTGATGGGATATTTTCTCCTG
gtaggtttctcttctcttcctcttctcaaggtttgggattcttaagaatacaaaatatga
agtaggtttatggaagaataatgccttaacattttttttggataccctgacttcctattt
tttcaagatgaaggctaacaaaaatgctacattctatatgaattaactaacaaaggctat
EXON 8  116 bp
ttcccagggtaaagggtccagtgggaagccccagcaatagggaagccagcaaaacctatc
aggatattatcctttcgcttcctgacctcccttgtctcttgagacaccagctcagcgttc
gtttttagaaacaataatcaaagagccccaacacctcccaatatgtccgcttgctgacag
GGGGCGCCATATCCAACATGTACAGCATCATGGCTGCTCGCTACAAGTACTTCCCGGAAG
TTAAGACAAAGGGCATGGCGGCTGTGCCTAAACTGGTCCTCTTCACCTCAGAACAG
gtgagtcggggatgctttctcatggatagtggtgttttttaggggactttccaacttcta
acctcgagcctctgtttgttgcagagtcactattccataaagaaagctggggctgcactt
ggctttggaactgacaatgtgattttgataaagtgcaatgaaaggtaggcaggggagggt
EXON 9  80 bp
tacagcatcatggctgctcgctacaagtacttcccggaagttaagacaaagggcatggcg
gctgtgcctaaactggtcctcttcacctcagaacaggtgagtcggggatgctttctcatg
gatagtggtgttttttaggggactttccaacttctaacctcgagcctctgtttgttgcag
AGTCACTATTCCATAAAGAAAGCTGGGGCTGCACTTGGCTTTGGAACTGACAATGTGATT
TTGATAAAGTGCAATGAAAG
gtaggcaggggagggtgaatattaggttcttgatgtattaaatgtgttcatctgttaaat
ttgttttattgtgcttaaggactggctcagtacattgtgccaagctgctaatggtctgtt
gaaaatatccgattaaattgctttttgctgctgctaaagtttttttcatgtgcaatctca
EXON 10  55 bp
gtgttcatctgttaaatttgttttattgtgcttaaggactggctcagtacattgtgccaa
gctgctaatggtctgttgaaaatatccgattaaattgctttttgctgctgctaaagtttt
tttcatgtgcaatctcattgactcttcattttaatttccctccttttccaataattatag
GGGGAAAATAATTCCAGCTGATTTTGAGGCAAAAATTCTTGAAGCCAAACAGAAG
gtatgtactccgtggtgcatctgaactccagttttaaaataccttctttctgtcctagac
aaaaacagtccttgataatatgagacaattttcttgtgcttctaaaattctattcttcaa
atttgcttatttccaactagtaaaataatttggttttaaagctgtgtctacacaatatca
EXON 11  117 bp
gaataaatgaatgaatgagtgaatgagccaacaaaacactactagacatagtatctggta
atacataagttttgccatttactgttagaaataaatgttacacaattcttcttcctgtga
aaatcagcaaatgagaaaggttaaaaatactcatcagcctatatctgtcttaccttgtag
GGATATGTTCCCTTTTATGTCAATGCAACTGCTGGCACGACTGTTTATGGAGCTTTTGAT
CCGATACAAGAGATTGCAGATATATGTGAGAAATATAACCTTTGGTTGCATGTCGAT
gtaagtgctatataactcaggccagtccatgtggggggtggaggcacctcttttttatga
cttgcctcaagcttctccccacgccccagccagccctctctccacaccacattagttcca
gttcttgtctggaccctagccagccattcacaactggtacacaccacagacctggaacat
EXON 12  65 bp
tgacaagcaatgaagaatcacaactgattgaacaatcagtgtgggctgaacttttctgag
aaacttatgtttttcaccttgtactttcttgctcatgttttagtagaagtgaggactgac
tagttttagattcttaaatgtcactgctcccctcttcctctcctttctctgtccccacag
GCTGCCTGGGGAGGTGGGCTGCTCATGTCCAGGAAGCACCGCCATAAACTCAACGGCATA
GAAAG
gtaacggccagaactcgccaggcctccttccacccagcacatcaaacagaccatgctctg
atgtcagcctgcaccaccctgccctgatccccagcatcatatttcggtctaagtttgctt
cagttcagcaggcatttgttgagcatttattggatgactgatttcccagtcaaatgagtc
EXON 13  79 bp
ccgtaatgtaatactccgagactgcctgcaaaacatttgtttgctacttgattagtcaat
tcaggagaataggcatggataatatttactaacttgagttggaatgggtgttttcctcaa
gagaacagttgcgtctttccaactcctgcaccttctcgaagtctcatgtgcttctttcag
GGCCAACTCAGTCACCTGGAACCCTCACAAGATGATGGGCGTGCTGTTGCAGTGCTCTGC
CATTCTCGTCAAGGAAAAG
gtctgtactccctccaaagctacactggggcccgtacgttctttagaaagcacaaaaaga
cacacgtggggtctctttgcagtacttgttggctgactcacgagattggcagccccactg
agagactactgctgctgtcctttcctgcccttgcagctaacctggtttcttctcttggct
EXON 14  150 bp
ggcagtttttccaagagtgattttagaaaagggcatcagaacaagtgtaaggcctcataa
agacatcagaagaaagattgcatatgaccccaagcccctccttccaagcagcctagtttt
aaagccacccacatctctgatgtgtaaatgcagatgcacccatcttaatttccatgatag
GGTATACTCCAAGGATGCAACCAGATGTGTGCAGGATACCTCTTCCAGCCAGACAAGCAG
TATGATGTCTCCTACGACACCGGGGACAAGGCAATTCAGTGTGGCCGCCACGTGGATATC
TTCAAGTTCTGGCTGATGTGGAAAGCAAAG
gtatgaagggaatagttcaggaaatagagcagaaatgtaatttgcacagactggctggca
aaagaggggcaaagatatatcacagataattcactatatggggaatcaatatctagataa
ttgaattaactgtgttttctttgtgaatgaaattactttattccttatgtcaaattctct
EXON 15  108 bp
cacatcatttattgcatgcacatctgtgaaaaagctgacatatttgattagattgttctt
cctaaccagctccaaaaatactttttttgtttatttcccatagacagggacagcatagcc
ttcccaaatgctcatcacagggaaatgcaaccacaaacatgacttttctctttaaaacag
GGCACAGTGGGATTTGAAAACCAGATCAACAAATGCCTGGAACTGGCTGAATACCTCTAT
GCCAAGATTAAAAACAGAGAAGAATTTGAGATGGTTTTCAATGGCGAG
gtaggtaatcatcatggaccaggtacacagtatttccagaaaaactgctgagggaagctc
ctgaagcttctggcaacatgggaaaatcaatcccatgttgccagaaactgcttcaaaatt
tttattcttatacactcttaattcctctctttaattccttccatgtctatgaacttttct
EXON 16  90 bp
atatgattggataaatgaggcattgttctccctggtgtggaagtaacattgcctttgaga
tgaacattcaacctctttctttggtccaagagacttccaccaaggatgcatattggtttg
ggaacagctttctctcaagttatcctaattttctttgtttgtcttttaaaatctctgcag
CCTGAGCACACAAACGTCTGTTTTTGGTATATTCCACAAAGCCTCAGGGGTGTGCCAGAC
AGCCCTCAACGACGGGAAAAGCTACACAAG
gtatggacttgctttttgtctcatctaatcctctgcaatttctctggctggtcaggacat
cctcattccaatgtgcctttctagtgggggaaatataaaaaataaagccttggggtgggt
ttctagtaatggggtggtggggagccatcctgttatattcctcttgagcctgcatcgccc
EXON 17  1431 bp
agggaacttgtgaccaggtagtcatttgatattagcccctgaagattcctggatatgaaa
tatttctttgcttttatgtcaatgtaaacacaaatagtaaaatgcaagttgggttgaatt
gttaaaaagagagggtgttcatatcaatcttgagttttgttttgtgttttccatcacaag
GTGGCTCCAAAAATCAAAGCCCTGATGATGGAGTCAGGTACGACCATGGTTGGCTACCAG
CCCCAAGGGGACAAGGCCAACTTCTTCCGGATGGTCATCTCCAACCCAGCCGCTACCCAG
TCTGACATTGACTTCCTCATTGAGGAGATAGAAAGACTGGGCCAGGATCTGTAATCATCC
TTCGCAGAACATGAGTTTATGGGAATGCCTTTTCCCTCTGGCACTCCAGAACAAACCTCT
ATATGTTGCTGAAACACACAGGCCATTTCATTGAGGGAAAACATAATATCTTGAAGAATA
TTGTTAAAACCTTACTTAAAGCTTGTTTGTTCTAGTTAGCAGGAAATAGTGTTCTTTTTA
AAAAGTTGCACATTAGGAACAGAGTATATATGTACAGTTATACATACCTCTCTCTATATA
TACATGTATAGTGAGTGTGGCTTAGTAATAGATCACGGCATGTTTCCCGCTCCAAGAGAA
TTCACTTTACCTTCAGCAGTTACCGAGGAGCTAAACATGCTGCCAACCAGCTTGTCCAAC
AACTCCAGGAAAACTGTTTTTCAAAACGCCATGTCCTAGGGGCCGAGGGAAATGCTGTTG
GTGAGAATCGACCTCACTGTCAGCGTTTCTCCACCTGAAGTGATGATGGATGAGAAAAAA
CACCACCAAATGACAAGTCACACCCTCCCCATTAGTATCCTGTTAGGGGAAAATAGTAGC
AGAGTCATTGTTACAGGTGTACTATGGCTGTATTTTTAGAGATTAATTTGTGTAGATTGT
GTAAATTCCTGTTGTCTGACCTTGGTGGTGGGAGGGGGAGACTATGTGTCATGATTTCAA
TGATTGTTTAATTGTAGGTCAATGAAATATTTGCTTATTTATATTCAGAGATGTACCATG
TTAAAGAGGCGTCTTGTATTTTCTTCCCATTTGTAATGTATCTTATTTATATATGAAGTA
AGTTCTGAAAACTGTTTATGGTATTTTCGTGCATTTGTGAGCCAAAGAGAAAAGATTAAA
ATTAGTGAGATTTGTATTTATATTAGAGTGCCCTTAAAATAATGATTTAAGCATTTTACT
GTCTGTAAGAGAATTCTAAGATTGTACATAAAGTCATATATATGGAAATCCTGTTACTTA
AATAGCATCTGCTCTTCTCTTACGCTCTCTGTCTGGCTGTACGTCTGGTGTTCTCAATGC
TTTTCTAGCAACTGTTGGATAATAACTAGATCTCCTGTAATTTTGTAGTAGTTGATGACC
AATCTCTGTGACTCGCTTAGCTGAAACCTAAGGCAACATTTCCGAAGACCTTCTGAAGAT
CTCAGATAAAGTGACCAGGCTCACAACTGTTTTTGAAGAAGGGAAATTCACACTGTGCGT
TTTAGAGTATGCAAGAAGAATATAAATAAATAAAAATATTCTCCATGGAGA
atttgaacaaaattttcttctagtttgtgtttcatacagagatgtttctaattagagttc
cttgggttgcccatagcccatttgctttctattggctgactttaggtgatgctcagtacc
ctgattaagctgaaggagactcgatccactgtcacaggctctgaagctcctcatctataa