Gene FSHR Variant 2
DNA : 191.98 KbNT_022184
mRNA : 2382 bp NM_000145
CDS : 4176 bp NP_000136
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  226 bp
catgcctaatggttctatttgctgtgtgccttaggtcagggtgtaagaaacccaatcttg
aaggaaaacagagtagcttatcttgcctggaagtaacaaaaaaaaaaaaaaaaagcatcc
cttggtgggtcacatgaccctaccagttctcaagtcagatctcttctcataagggcactg
TGTGGAGCTTCTGAGATCTGTGGAGGTTTTTCTCTGCAAATGCAGGAAGAAATCAGGTGG
ATGGATGCATAATTATGGCCCTGCTCCTGGTCTCTTTGCTGGCATTCCTGAGCTTGGGCT
CAGGATGTCATCATCGGATCTGTCACTGCTCTAACAGGGTTTTTCTCTGCCAAGAGAGCA
AGGTGACAGAGATTCCTTCTGACCTCCCGAGGAATGCCATTGAACT
gtgagtatcagagggagggggaacaactgcatggctggcatttgtgcattgcgtactatt
attatttttacattaggctgatatctgttagactgaaatatttctgccccttgaccgaag
tcctgaataaaacaactaactccccagcccaaccctcctgcctgtggctttccaagaatc
EXON 2  72 bp
taatagtttcagtatcactagttgtagacaggatgaaaagagagaatgtaaaagcaattt
caacattactttatggcaagcacttagtatatggtaactgtttgctgatatgaatacatt
agcaactcaattacttattaatggataggttgtgatattttatttctactctctttgcag
GAGGTTTGTCCTCACCAAGCTTCGAGTCATCCAAAAAGGTGCATTTTCAGGATTTGGGGA
CCTGGAGAAAAT
gtatgtacctagcactgctgtgagtgaatgcctcaagggggctatagggagcaacctcag
accacatctagtatgactatctgcacttagtagccgaactgacatggtcagccaaacttt
ctgcatctcctcacattttactgtgttaccatggttcctaaatgatagtgtggagtcttt
EXON 3  75 bp
taagtgttagcctctagtatgttagttttgccttattactacagctgacttctttaatgg
caggaaaggagttttgtgtgtcttgtgaatcctcccagacacaaggctctatgctgagcc
ctaaaaatattcaaggagtgtaactgaactggcttgacttatatatttttttctccacag
AGAGATCTCTCAGAATGATGTCTTGGAGGTGATAGAGGCAGATGTGTTCTCCAACCTTCC
CAAATTACATGAAAT
gtaagcaagaagattgggggatttgctcatggccattcttgaaaaaacccttaaagttct
tctacattcctgggaggccctgattctgccatggcctcagatccctagattgtcattata
agatgtcaaaatcagcctaaaaggcactgtaatgtgtctctatctggtgacccagggacc
EXON 4  75 bp
aaaaggcactgcatgctccctcaatatttattgaaatgatggatggatggatggatggat
gaatagatgggtggatgagtggatgggatgaatgatttattatgtactctgtaaaatgtg
aaaaatactacagcattccttaccatcaagatcactagcatgttttttcttcttttacag
TAGAATTGAAAAGGCCAACAACCTGCTCTACATCAACCCTGAGGCCTTCCAGAACCTTCC
CAACCTTCAATATCT
gtaagaactcatgtagtttggtacccccactatgattaaatagtgcaagcctattttact
aaaaggcctacttgatactctggggagcaattacttttgatcaaggatggtggtgggggg
cagaagtggaggtggagagatacttggtgatggattttagtttaatgagcaaattctact
EXON 5  72 bp
aagaccgtggaacgaaccttaaaatagaaaacatgagcctaattcacgtatatacgggct
tttctcgtagatttttctgatggttcaaaattgatatttttattctggaaagttcatgct
ctaacaactgtttaaacagccagtttcattttcactcactctcattttgtttctctctag
GTTAATATCCAACACAGGTATTAAGCACCTTCCAGATGTTCACAAGATTCATTCTCTCCA
AAAAGTTTTACT
gtaagttttttccttgagtgactaccaactctttactcagtatctgtcttgcccaacggc
tatctgggcctttaatatgcattgtgtagtctacatcctccaaatgtattgctctgggtt
agcaaagatagggaggccagaagtgaggtccttgattttacctgcaggccagtcaatatt
EXON 6  78 bp
aaagataaattagagacaattttttctccaaactttgagctgatcatcttctaaacaaca
actagttatattaatacattacctcagctgaagaccgcatcatgccagttaaactaaatt
ttggaaggttacatgagtagagctgatgtaagtatcttatttgtctgtactttcttctag
TGACATTCAAGATAACATAAACATCCACACAATTGAAAGAAATTCTTTCGTGGGGCTGAG
CTTTGAAAGTGTGATTCT
gtaagtaagggggaaaaaatccaacagagtaacatttgatttttcatttagtgatctctt
tctcataattggatgctccttttttgtttgggtaactttggcatttctccacttaaatca
ctctccagttctgcgttcctctctcatctttacatttcagaatcacaatgtggagtcatg
EXON 7  69 bp
caaaagattatacagcaataaatcagtcttcctcccacccgtgtccccaagctttaaaag
tggcattttctttatgccactaacctgtgctgtctgcccttgctcagtgcttccaattat
gaaacccgtgtattgtttgcatctgacattattggttttttaataggccttttatttcag
ATGGCTGAATAAGAATGGGATTCAAGAAATACACAACTGTGCATTCAATGGAACCCAACT
AGATGAGCT
gtaagtagccctgactattcttcaaggccatttaaagggaaatggctcttacaacagcaa
tatttatgtggctttgtgttttccttcttctttcctcaaccccatccccaggaatctaag
cgataataataatttagaagaattgcctaatgatgttttccacggagcctctggaccagt
EXON 8  75 bp
atggctgaataagaatgggattcaagaaatacacaactgtgcattcaatggaacccaact
agatgagctgtaagtagccctgactattcttcaaggccatttaaagggaaatggctctta
caacagcaatatttatgtggctttgtgttttccttcttctttcctcaaccccatccccag
GAATCTAAGCGATAATAATAATTTAGAAGAATTGCCTAATGATGTTTTCCACGGAGCCTC
TGGACCAGTCATTCT
gtgagtagctttccccatttctgtgtgtaagagctcagtttgtgtaagttagaagtcaac
tctctgcagctaggggagaagcttccaacacagggctggccatcaagttcaatttttatt
cgtgtcatctgcaaaaatttatagagacaatttaaggcttatccacggtctaactctcca
EXON 9  186 bp
cagaaccaaatgtcctattagccaaatatccatctggccaaggtgtgttggaggaaccgg
agtctctctcctcatccatgtaagaatatcactagtgtgtctgctattttgcctgctaac
caagagcagaaagttttaggtccatagtaatcctgttatatttaccttttctctttatag
AGATATTTCAAGAACAAGGATCCATTCCCTGCCTAGCTATGGCTTAGAAAATCTTAAGAA
GCTGAGGGCCAGGTCGACTTACAACTTAAAAAAGCTGCCTACTCTGGAAAAGCTTGTCGC
CCTCATGGAAGCCAGCCTCACCTATCCCAGCCATTGCTGTGCCTTTGCAAACTGGAGACG
GCAAAT
gtgagtccatcctttaagccctgctcaggcatttccccaatgtagaactttgtccacaat
ttctacctatctgtgacatgaagagaatctacttgcagagagttccctgtctcaagccct
ttggcacattctgggtcaaaaattcagttcatggagagtgaggaatagttgaactctttc
EXON 10  1454 bp
tattcatttacagtaagcagcattaacccttgaggttagcctcaagggcaggtatgatgt
gagaagaaaaaaaaaaaatctcaggaagaaactcatcatttctaccctgcacaaagacag
tgatgtatttgctatactggatctgagatgttgattctatttctttttgtatttttctag
CTCTGAGCTTCATCCAATTTGCAACAAATCTATTTTAAGGCAAGAAGTTGATTATATGAC
TCAGGCTAGGGGTCAGAGATCCTCTCTGGCAGAAGACAATGAGTCCAGCTACAGCAGAGG
ATTTGACATGACGTACACTGAGTTTGACTATGACTTATGCAATGAAGTGGTTGACGTGAC
CTGCTCCCCTAAGCCAGATGCATTCAACCCATGTGAAGATATCATGGGGTACAACATCCT
CAGAGTCCTGATATGGTTTATCAGCATCCTGGCCATCACTGGGAACATCATAGTGCTAGT
GATCCTAACTACCAGCCAATATAAACTCACAGTCCCCAGGTTCCTTATGTGCAACCTGGC
CTTTGCTGATCTCTGCATTGGAATCTACCTGCTGCTCATTGCATCAGTTGATATCCATAC
CAAGAGCCAATATCACAACTATGCCATTGACTGGCAAACTGGGGCAGGCTGTGATGCTGC
TGGCTTTTTCACTGTCTTTGCCAGTGAGCTGTCAGTCTACACTCTGACAGCTATCACCTT
GGAAAGATGGCATACCATCACGCATGCCATGCAGCTGGACTGCAAGGTGCAGCTCCGCCA
TGCTGCCAGTGTCATGGTGATGGGCTGGATTTTTGCTTTTGCAGCTGCCCTCTTTCCCAT
CTTTGGCATCAGCAGCTACATGAAGGTGAGCATCTGCCTGCCCATGGATATTGACAGCCC
TTTGTCACAGCTGTATGTCATGTCCCTCCTTGTGCTCAATGTCCTGGCCTTTGTGGTCAT
CTGTGGCTGCTATATCCACATCTACCTCACAGTGCGGAACCCCAACATCGTGTCCTCCTC
TAGTGACACCAGGATCGCCAAGCGCATGGCCATGCTCATCTTCACTGACTTCCTCTGCAT
GGCACCCATTTCTTTCTTTGCCATTTCTGCCTCCCTCAAGGTGCCCCTCATCACTGTGTC
CAAAGCAAAGATTCTGCTGGTTCTGTTTCACCCCATCAACTCCTGTGCCAACCCCTTCCT
CTATGCCATCTTTACCAAAAACTTTCGCAGAGATTTCTTCATTCTGCTGAGCAAGTGTGG
CTGCTATGAAATGCAAGCCCAAATTTATAGGACAGAAACTTCATCCACTGTCCACAACAC
CCATCCAAGGAATGGCCACTGCTCTTCAGCTCCCAGAGTCACCAGTGGTTCCACTTACAT
ACTTGTCCCTCTAAGTCATTTAGCCCAAAACTAAAACACAATGTGAAAATGTATCTGAGT
ATTGAATGATAATTCAGTCTTGCCTTTGAAGGGTATGTCACAAAGAGCTGACAGTGCTTC
TACACATTTCATCTAATTTAATATTCCTGGCATACCTTTAAGGTAAATTGGTCAGGAACT
ATTAATTCCATGTGATACATTAGGAAGCTGAATTATTAGTAACAACAATAATAATTAAAG
AATGCAATACTGTA
ttacatattttatccttatatatgttatttttgcacgttatgttcaaagtgcttttgttc
agatatctcaagtgatccctgttaaataagcaggacagggattattcttggagttttaca
aatgaggaaaccacgactcaaagagttaagtgacttgttcaaaattgtttagtttgtaag