Gene FKBP1B Variant 2
DNA : 13.92 KbNT_022184
mRNA : 905 bp NM_004116
CDS : 327 bp NP_004107
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  129 bp
tgtcgtcaggcggggccaggctcgctaacagccgggcggggtcccttcccccgggccccg
ccccggccgaccccacctttccgcgcggctccgccccgccgcccccttgccagtggcccc
tccccgcgcaggtcccgactccagccgcacctcctccggctctgcagtggcggcgaggag
GCGAGCCGGAGCGACGGCGGGGCTGGGGCCGGAGCCGAGCCGGGGTCGGGCAGCAGCAGG
GACCCCCCAGAGGCGGGGCCTGTGGGACCGCTATGGGCGTGGAGATCGAGACCATCTCCC
CCGGAGACG
gtaccgggctccctccggagccaggggaggggaggggtcccggggcggagcccggagggc
gggggtctgattcggaggtggcgtggagggtgctgaagggtcggggggctggatggggaa
ggcaggcggagacgccggacgggattcttgggggtctaggagaccatcctccgccatcct
EXON 2  48 bp
ccagagaggtgacgtgattcattctggctcgtacagggcccagagccagaactagggcca
caggcatctccatggcatggaggggaatgcaggctggagctcttggtcaggatcatactt
aatgtcccaggtgtttttccaatatcctactccttcatctgccctcatgtctccctgcag
GAAGGACATTCCCCAAGAAGGGCCAAACGTGTGTGGTGCACTACACAG
gtaagtctcaccccctcagcccccacccagtccttcccctcccaaggcagggctgtcctc
tgagcttctctccagaggtgcctgcctctggatcagggctaaagcccaaggcagcagggt
ctccctgtgaccagccatcctctactcctcccagccagtctagtgggaatgataaaggag
EXON 3  113 bp
atgtgggggtgaggcagaaggaagtgtccagatttcctgcttgggcaacaggatggatgg
ggaggatcggaagaggagcaggtgtgtgcagaaaaggcattccattttagacatgtggaa
tctgaattgggagtttactcatgaccacagctctattgcacccgattcttgctttgacag
GAATGCTCCAAAATGGGAAGAAGTTTGATTCATCCAGAGACAGAAACAAACCTTTCAAGT
TCAGAATTGGCAAACAGGAAGTCATCAAAGGTTTTGAAGAGGGTGCAGCCCAG
gtaggatgaggattcgcattaaaggggatctggggagttggggatctgggatcagcactc
tgccctccacctccaccttcacccactcacagaccactactgctttgactctacagccag
ggcatggcaacgccatctggtgtcccctcctggctttgcgtccccacccctctccttgcc
EXON 4  615 bp
gaatctgcgtttgttaaagctgttagcacgatttcaatgtatcccatgtaaaattcatct
gagatcttcagagttaacattgaggatggtttgggaaaatgccatagtcatctaactttt
ttcttttaaatcaagctgggtcctctttctcctctccccatctgcccccatccctgctag
ATGAGCTTGGGGCAGAGGGCGAAGCTGACCTGCACCCCTGATGTGGCATATGGAGCCACG
GGCCACCCCGGTGTCATCCCTCCCAATGCCACCCTCATCTTTGACGTGGAGCTGCTCAAC
TTAGAGTGAAGGCAGGAAGGAACTCAAGGTGGCTGGAGATGGCTGCTGCTCACCCTCCTA
GCCTGCTCTGCCACTGGGACGGCTCCTGCTTTTGGGGCTCTTGATCAGTGTGCTAACCTC
ACTGCCTCATGGCATCATCCATTCTCTCTGCCCAAGTTGCTCTGTATGTGTTCGTCAGTG
TTCATGCGAATTCTTGCTTGAGGAAACTTCGGTTGCAGATTGAAGCATTTCAGGTTGTGC
ATTTTGTGTGATGCATGTAGTAGCCTTTCCTGATGACAGAACACAGATCTCTTGTTCGCA
CAATCTACACTGCCTTACCTTCACTTAAACCACACACACAAGGTGCTCAGACATGAAATG
TACATGGCGTACCGTACACAGAGGGACTTGAGCCAGTTACCTTTGCTGTCACTTTCTCTC
TTATAAATTCTGTTAGCTGCTCACTTAAACAATGTCCTCTTTGAGAAAATGTAAAATAAA
GGCTCTGTGCTTGAC
aaactcctgtccatccttattttaggtaggaagtgctctaaggaccacacaagccaggtg
cccttgggaaagagtggaaagaaaggagggttccaagtggctaggtgagtgataaatata
atagctacaatgtgagcattttacatgctgggccttgttctacatacttttttattttat