Gene FKBP1B Variant 1
DNA : 13.92 KbNT_022184
mRNA : 950 bp NM_054033
CDS : 3108 bp NP_473374
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  129 bp
tgtcgtcaggcggggccaggctcgctaacagccgggcggggtcccttcccccgggccccg
ccccggccgaccccacctttccgcgcggctccgccccgccgcccccttgccagtggcccc
tccccgcgcaggtcccgactccagccgcacctcctccggctctgcagtggcggcgaggag
GCGAGCCGGAGCGACGGCGGGGCTGGGGCCGGAGCCGAGCCGGGGTCGGGCAGCAGCAGG
GACCCCCCAGAGGCGGGGCCTGTGGGACCGCTATGGGCGTGGAGATCGAGACCATCTCCC
CCGGAGACG
gtaccgggctccctccggagccaggggaggggaggggtcccggggcggagcccggagggc
gggggtctgattcggaggtggcgtggagggtgctgaagggtcggggggctggatggggaa
ggcaggcggagacgccggacgggattcttgggggtctaggagaccatcctccgccatcct
EXON 2  48 bp
ccagagaggtgacgtgattcattctggctcgtacagggcccagagccagaactagggcca
caggcatctccatggcatggaggggaatgcaggctggagctcttggtcaggatcatactt
aatgtcccaggtgtttttccaatatcctactccttcatctgccctcatgtctccctgcag
GAAGGACATTCCCCAAGAAGGGCCAAACGTGTGTGGTGCACTACACAG
gtaagtctcaccccctcagcccccacccagtccttcccctcccaaggcagggctgtcctc
tgagcttctctccagaggtgcctgcctctggatcagggctaaagcccaaggcagcagggt
ctccctgtgaccagccatcctctactcctcccagccagtctagtgggaatgataaaggag
EXON 3  113 bp
atgtgggggtgaggcagaaggaagtgtccagatttcctgcttgggcaacaggatggatgg
ggaggatcggaagaggagcaggtgtgtgcagaaaaggcattccattttagacatgtggaa
tctgaattgggagtttactcatgaccacagctctattgcacccgattcttgctttgacag
GAATGCTCCAAAATGGGAAGAAGTTTGATTCATCCAGAGACAGAAACAAACCTTTCAAGT
TCAGAATTGGCAAACAGGAAGTCATCAAAGGTTTTGAAGAGGGTGCAGCCCAG
gtaggatgaggattcgcattaaaggggatctggggagttggggatctgggatcagcactc
tgccctccacctccaccttcacccactcacagaccactactgctttgactctacagccag
ggcatggcaacgccatctggtgtcccctcctggctttgcgtccccacccctctccttgcc
EXON 4  660 bp
actctgtgagggttactgccccacagtcacatctctgctgaggcagaatctgcgtttgtt
aaagctgttagcacgatttcaatgtatcccatgtaaaattcatctgagatcttcagagtt
aacattgaggatggtttgggaaaatgccatagtcatctaacttttttcttttaaatcaag
CTGGGTCCTCTTTCTCCTCTCCCCATCTGCCCCCATCCCTGCTAGATGAGCTTGGGGCAG
AGGGCGAAGCTGACCTGCACCCCTGATGTGGCATATGGAGCCACGGGCCACCCCGGTGTC
ATCCCTCCCAATGCCACCCTCATCTTTGACGTGGAGCTGCTCAACTTAGAGTGAAGGCAG
GAAGGAACTCAAGGTGGCTGGAGATGGCTGCTGCTCACCCTCCTAGCCTGCTCTGCCACT
GGGACGGCTCCTGCTTTTGGGGCTCTTGATCAGTGTGCTAACCTCACTGCCTCATGGCAT
CATCCATTCTCTCTGCCCAAGTTGCTCTGTATGTGTTCGTCAGTGTTCATGCGAATTCTT
GCTTGAGGAAACTTCGGTTGCAGATTGAAGCATTTCAGGTTGTGCATTTTGTGTGATGCA
TGTAGTAGCCTTTCCTGATGACAGAACACAGATCTCTTGTTCGCACAATCTACACTGCCT
TACCTTCACTTAAACCACACACACAAGGTGCTCAGACATGAAATGTACATGGCGTACCGT
ACACAGAGGGACTTGAGCCAGTTACCTTTGCTGTCACTTTCTCTCTTATAAATTCTGTTA
GCTGCTCACTTAAACAATGTCCTCTTTGAGAAAATGTAAAATAAAGGCTCTGTGCTTGAC

aaactcctgtccatccttattttaggtaggaagtgctctaaggaccacacaagccaggtg
cccttgggaaagagtggaaagaaaggagggttccaagtggctaggtgagtgataaatata
atagctacaatgtgagcattttacatgctgggccttgttctacatacttttttattttat