Gene EIF2B4 Variant 1
DNA : 5.97 KbNT_022184
mRNA : 1617 bp NM_015636
CDS : 1561 bp NP_056451
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  50 bp
gtggagttggccctcattgcaacccgtagtgcggggcggggcctcggggcccgtcggaaa
ttgtagtccgattggggctgcgcgcttcgcttctgcggctcagcctccagcccaggtggc
gctgtggaccctgcagccgcggagcgaggcagcggggcggctccgtgaccacggcgggcg
GAGCCTAGGACTGAGGGCGATGGCTGCTGTGGCCGTGGCTGTTCGCGAGG
gtgagtgaagagccgggcctgcctactggtacgcggagccgacgagctccggacagctag
tgccgggccttgagcgcctttgggccccgccgctccgttccagcgccacgctgggctccg
gtctacacagtctcgagcgcagtcccgcgccgcgcaccggctggttgctgtgaggagggt
EXON 2  44 bp
gacccctccattcctttgatccgccgcgcagtgcgtccccacgcggatccctggctcgcc
tcgcgcctgccggcggatccgtggtcatgccaacccagcagccggctgcgccgagtactc
gtgcccccaaaccctcccggagtctctctggctcactttgtgccctgttttctgatgcag
ACTCGGGATCCGGGATGAAGGCGGAGCTTCCCCCTGGGCCTGGG
gtaagtgaggcttccctcccaagccgcctgccaagcgctacgcaggaggctgtgccagct
ttattccgccccagctcccatcccgtgtcggtttatttctcagtaaagccaggagatttt
acagaggtcttgcaaccctagggatatatgattctgtccctggaggagaaacgtcagcct
EXON 3  136 bp
tatgattctgtccctggaggagaaacgtcagcctctgtggatgtaagcttgcaacaggta
gcttgtggaagttaggaagaactagggatttaaccatgtggaaatcttgtaagcatccaa
tagtatttgttcccctttggaattgttggggaagagcagtatcctatgtctgtgtctcag
GCAGTGGGGAGGGAAATGACCAAAGAAGAAAAGCTGCAGCTTCGGAAGGAAAAGAAACAG
CAGAAGAAGAAACGGAAGGAAGAAAAGGGGGCAGAACCAGAGACTGGCTCTGCTGTATCT
GCAGCCCAATGTCAAG
gtgagtgaggggtctcttttaaagggctggggtgtggagctggtagagggatgtggtggg
agagataagggagagacaggacaaagttgatttgagcaagtgtgtaaagcaaagaggttt
acaaggagagaagctagttttagctggggcacggatatcacctgcctgcagcttgggcat
EXON 4  204 bp
ggctggggtgtggagctggtagagggatgtggtgggagagataagggagagacaggacaa
agttgatttgagcaagtgtgtaaagcaaagaggtttacaaggagagaagctagttttagc
tggggcacggatatcacctgcctgcagcttgggcatttttttttttaatgcttttagtag
GCCCAACCAGAGAACTGCCAGAATCGGGCATTCAGTTGGGCACTCCTCGGGAGAAAGTTC
CAGCTGGTCGGAGTAAGGCCGAACTTCGGGCTGAGCGTCGAGCCAAGCAGGAGGCCGAGC
GGGCCCTGAAACAGGCAAGAAAAGGGGAACAAGGAGGACCACCTCCTAAGGCCAGCCCCA
GCACAGCTGGAGAAACCCCCTCAG
gtatcttcccttcattttaagacctcccttactcctaattataacgccagctcaggctgc
ccaatagtaaaacagctctcccctctcattcttgggacccagagttctgaattgttcctg
caaccccattatcctatccctatttccttttctaccctattctcccgttttctccacctc
EXON 5  80 bp
tgggacccagagttctgaattgttcctgcaaccccattatcctatccctatttccttttc
taccctattctcccgttttctccacctcatcctgtttttcttgatgccccttatacccta
agagcaaattacacatttcaagacctacagtgtcctgaaaacatgatgattatctttcag
GAGTGAAGCGTCTCCCTGAGTACCCTCAGGTTGATGACCTACTTCTGAGAAGGCTTGTTA
AAAAACCAGAGCGTCAACAG
gtaggaagtgggtttggtgcctggctagaaagagcctagggaaatggactggagggagga
aaggtgctgggtgcaaagtgagaaggataggtgcttgggtcagagtagtcttactgttca
cttcctttccagctttatcccatcctttttaaactctgggccattggtcctgttcccttg
EXON 6  81 bp
ggtttggtgcctggctagaaagagcctagggaaatggactggagggaggaaaggtgctgg
gtgcaaagtgagaaggataggtgcttgggtcagagtagtcttactgttcacttcctttcc
agctttatcccatcctttttaaactctgggccattggtcctgttcccttgttttgtcaag
GTTCCTACACGAAAGGATTATGGATCCAAAGTCAGTCTCTTCTCTCACCTACCCCAGTAC
AGCAGACAAAACTCTCTGACC
cagtttatgaggtaggatcctatgaaattgtcataacttttgagtctgaggagttttagt
aagtcagtattgaaagtttctagtaatctgagatggactctgtaggaaaaagtatgaacc
caaggcagaactgtagaggagtggggaaatctgctagtgaagggagttccttttcatcag
EXON 7  118 bp
aagtcagtattgaaagtttctagtaatctgagatggactctgtaggaaaaagtatgaacc
caaggcagaactgtagaggagtggggaaatctgctagtgaagggagttccttttcatcag
gggcaggtgggcagtagatgctcaagctccctttcaaagtatgtgacaccgccatcccat
CAGCATCCCATCCTCTGTGATCCACCCAGCCATGGTGCGACTCGGCCTGCAGTACTCCCA
GGGCCTGGTCAGTGGCTCCAATGCCCGGTGTATTGCCCTGCTTCGTGCCTTGCAGCAG
gtatgtcccatcctgttctctcttatgatccaaccccacctcccccaatactaccccagc
ttctgtcacccaaggtcatctctgggggacagagggaatactcctaccctcagaacattt
tcctcagtgaagcttacccccagcccccgttcagagatctttattaaggggtattttgca
EXON 8  77 bp
ttatgatccaaccccacctcccccaatactaccccagcttctgtcacccaaggtcatctc
tgggggacagagggaatactcctaccctcagaacattttcctcagtgaagcttaccccca
gcccccgttcagagatctttattaaggggtattttgcagatcaccttgtgtaccctatag
GTGATTCAGGATTACACAACACCGCCTAATGAAGAACTCTCCAGGGATCTAGTGAATAAA
CTAAAACCCTACATGAG
gtagggacaacactataagtccactcccagctcgcccaatctttgtcttgtactcttttt
cctgcttttctatctctcttttcattttgtgttctattttctttttaaagactttttttt
taaatgtgaaggctttgtaagttgtgaagagttgcgcagatataaggtattgctgttgta
EXON 9  103 bp
acaacactataagtccactcccagctcgcccaatctttgtcttgtactctttttcctgct
tttctatctctcttttcattttgtgttctattttctttttaaagactttttttttaaatg
tgaaggctttgtaagttgtgaagagttgcgcagatataaggtattgctgttgtattatag
CTTCCTGACTCAGTGCCGTCCCCTGTCAGCGAGCATGCACAACGCCATCAAGTTCCTTAA
CAAGGAAATCACCAGTGTGGGCAGTTCCAAGCGGGAAGAGGAG
gtgatgagtatgagaaataaggaaggcatgcacctgtgggtaaaattaagaaacatgtta
aaaactcccgggaaggccaacgtaagcctttttttgccctagtcaagggttaaggaatgg
tttggccattctgacttgtgccatctctgagccctctataggcttgtcatcatacacata
EXON 10  128 bp
gccaacgtaagcctttttttgccctagtcaagggttaaggaatggtttggccattctgac
ttgtgccatctctgagccctctataggcttgtcatcatacacatattcaagcacctggca
tgatcatcagagggataaaagtgtccatttcttgttcactaaggattttactccatttag
GCCAAGTCAGAACTTCGAGCAGCCATTGATCGGTATGTGCAAGAGAAGATTGTGCTAGCA
GCTCAGGCAATTTCACGCTTTGCTTACCAGAAGATCAGTAATGGAGATGTGATCCTGGTA
TATGGATG
gtatggtccagaccttgtgactgagcagattgggagttggaatgatctgaagaagggact
acccacttgcctttgggaataagttagtcatcagttactgacatttataactgaatcctc
ctcttcattcactctagctcatctctggtatcacgaattcttcaggaggcttggacagag
EXON 11  178 bp
accagaagatcagtaatggagatgtgatcctggtatatggatggtatggtccagaccttg
tgactgagcagattgggagttggaatgatctgaagaagggactacccacttgcctttggg
aataagttagtcatcagttactgacatttataactgaatcctcctcttcattcactctag
CTCATCTCTGGTATCACGAATTCTTCAGGAGGCTTGGACAGAGGGCCGGCGGTTTCGGGT
GGTAGTGGTGGACAGCCGGCCATGGCTGGAAGGAAGGCACACACTACGTTCTCTAGTCCA
TGCTGGTGTCCCAGCCTCCTACCTGCTGATTCCTGCAGCCTCCTATGTGCTCCCAGAG
gtaagtacagaggaaaaggactccaaagttggcggtgaaaaggtgtagtagtatagacat
aatctcaccttcccaaagttacagttttgtttttgttttgagataaggatggagtgcagc
gacgtgatcacagctcactgcagtcttgacctcctgggctcaggtgatcttcccacctcc
EXON 12  181 bp
atctcaaagaaaaaaaaaaaaaagatttattacttgttgtctgtttttgtttctttccct
tcttttcacaggtgttgagatttattacttgtcttaatgttgctgtcctgtaagtagggg
accttattttgcattgatacaacaatgacatttttttcttcctcttctcctgtgaaacag
GTTTCCAAGGTGCTATTGGGAGCTCATGCACTCTTGGCCAACGGGTCTGTGATGTCACGG
GTAGGGACAGCACAGTTAGCCCTGGTGGCTCGAGCCCATAATGTACCAGTGCTGGTTTGC
TGTGAAACATACAAGTTCTGTGAGCGTGTGCAGACTGATGCCTTTGTCTCTAATGAGCTA
G
gtaaggaggcaaaagagaagcctccagctacctgtgaagacttgagagggagggagaggg
gcggataaactagaacttcttttctgaaagaacataatgggtacgccttccattgcagat
gaccctgatgatctgcaatgtaagcggggagaacatgttgcgctggctaactggcagaac
EXON 13  237 bp
ctgtgaaacatacaagttctgtgagcgtgtgcagactgatgcctttgtctctaatgagct
aggtaaggaggcaaaagagaagcctccagctacctgtgaagacttgagagggagggagag
gggcggataaactagaacttcttttctgaaagaacataatgggtacgccttccattgcag
ATGACCCTGATGATCTGCAATGTAAGCGGGGAGAACATGTTGCGCTGGCTAACTGGCAGA
ACCACGCATCCCTACGGTTGTTGAATCTAGTCTATGATGTGACTCCCCCAGAGCTTGTGG
ATCTGGTGATCACGGAGCTGGGGATGATCCCTTGCAGTTCTGTACCTGTTGTTCTACGAG
TCAAGAGCAGTGACCAGTGACGGGGGAAACACAGGGTTAATAAATGCCATACTCCCT
accctcagcaactctgctgcctttgtttctcttttagcatctccaccacttaagttagga
gtccagacttcacaaccccttttatcacctgctactcagacctttgtgaagacctgctca
agtaactagctccatgccagtacattgggactaacctgaagacccgtataaagaaccaaa