Gene EIF2AK3 Variant 1
DNA : 70.83 KbNT_022184
mRNA : 4646 bp NM_004836
CDS : 3348 bp NP_004827
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  610 bp
gccaaccaccgcgatggccaatctgttgtaggaaaggtattccgggaactgatgagcgca
ccaatcaggtaaaaagacgtcggggaagggcatttctcattggtaattgcgtccggaaga
gggacgggcctcgaacgacgaaattacgatttgattggtaggtgcgatgttgaccaccag
GGAAAGTCCACCTTCCCCAACAAGGCCAGCCTGGGAACATGGAGTGGCAGCGGCCGCAGC
CAATGAGAGAGCAAACGCGCGGAAAGTTTGCTCAATGGGCGATGTCCGAGATAGGCTGTC
ACTCAGGTGGCAGCGGCAGAGGCCGGGCTGAGACGTGGCCAGGGGAACACGGCTGGCTGT
CCAGGCCGTCGGGGCGGCAGTAGGGTCCCTAGCACGTCCTTGCCTTCTTGGGAGCTCCAA
GCGGCGGGAGAGGCAGGCGTCAGTGGCTGCGCCTCCATGCCTGCGCGCGGGGCGGGACGC
TGATGGAGCGCGCCATCAGCCCGGGGCTGCTGGTACGGGCGCTGCTGCTGCTGCTGCTGC
TGCTGGGGCTCGCGGCAAGGACGGTGGCCGCGGGGCGCGCCCGTGGCCTCCCAGCGCCGA
CGGCGGAGGCGGCGTTCGGCCTCGGGGCGGCCGCTGCTCCCACCTCAGCGACGCGAGTAC
CGGCGGCGGGCGCCGTGGCTGCGGCCGAGGTGACTGTGGAGGACGCTGAGGCGCTGCCGG
CAGCCGCGGGAGAGCAGGAGCCTCGGGGTCCGGAACCAGACGATGAGACAGAGTTGCGAC
CGCGCGGCAG
gtgaggggctgccgacccgggggaggcaacttgtttacgcgcgcgagccgcggaggatgc
ggtgtaggggggcggagatccgggacccgggcgggcgtcttccctcggctgcggagggca
gctggcgacctggggacgagcgcggggccacgacgccctcccatcccccggccagcgacc
EXON 2  130 bp
taaagggcatattgaaattgtcttggtccaaagacagtggtggcaagagtggtagaaggc
cccctcttcctttctacgaatagaggcctggacatgggctggttttcttttgagcatgtg
ggataagtgcccaatatcttagatatctgttaattttaaaaatatttttaatatttacag
GTCATTAGTAATTATCAGCACTTTAGATGGGAGAATTGCTGCCTTGGATCCTGAAAATCA
TGGTAAAAAGCAGTGGGATTTGGATGTGGGATCCGGTTCCTTGGTGTCATCCAGCCTTAG
CAAACCAGAG
gtaagaattttctgttaactgttgactagaaaacttaattctaatgagtaattgctgata
ttaagaagtttggggccctattgcccaggtttgaggcctgtctgcctcttacagtttgtg
tccctttagggcaattacttaacttttctattcctcagttcccctcttgtgaaatgagat
EXON 3  195 bp
gatggactgcactgcttcatgtgctactcagaaggaggctggagtacatcaggatcaaga
ctccagctcttaattactattattcttttaaaggtatgatgcttctatttttctgggaga
aataagaaaaaaataataattaatgttatggcccttttaaaaagttagcttctgttttag
GTATTTGGGAATAAGATGATCATTCCTTCCCTGGATGGAGCCCTCTTCCAGTGGGACCAA
GACCGTGAAAGCATGGAAACAGTTCCTTTCACAGTTGAATCACTTCTTGAATCTTCTTAT
AAATTTGGAGATGATGTTGTTTTGGTTGGAGGAAAATCTCTGACTACATATGGACTCAGT
GCATATAGTGGAAAG
gtaagtgaaaatgctgaatttactttggggaaatcagagtaaattagggtagaaaaagta
atttattaaactacacttattattagttgagttttattgtaattttcccctgaggttgtc
atttgttttaataagagaactgtgaggtaggaaggggaaactaataacagaataaatggc
EXON 4  134 bp
gttctaaataactcattttaggagttggtaatctaactgatgcttcttatgacttgagta
cttcatacacatttccttagtttcctttcactttttaaaaattacagattcctttaatat
ctctgatctattatgagttgtctccttttactaattttgtatctaattttgtcttttcag
GTGAGGTATATCTGTTCAGCTCTGGGTTGTCGCCAATGGGATAGTGACGAAATGGAACAA
GAGGAAGACATCCTGCTTCTACAGCGTACCCAAAAAACTGTTAGAGCTGTCGGACCTCGC
AGTGGCAATGAGAA
gtgtgtattcagataatgttgctgttggtattatttagaaatacacctaataccaaaatt
tatcagatttctgtttgtggagattttgactattttgttgccttaaaagcatatatatat
atatttttttgatacggagtcttgctctgtcgcccaggcttgagtacagtggcgtgatat
EXON 5  235 bp
aaagttcttgtgggccctcttgtggcataaatcagtagagcactcttttccagaaggtta
tgttgttagttttctcatcacataattttagtatttgcttcttcaatctagaagagttct
atattattttgtccctttctttaaatgtaaatttctaaaacacacctttgtaaatttaag
GTGGAATTTCAGTGTTGGCCACTTTGAACTTCGGTATATTCCAGACATGGAAACGAGAGC
CGGATTTATTGAAAGCACCTTTAAGCCCAATGAGAACACAGAAGAGTCTAAAATTATTTC
AGATGTGGAAGAACAGGAAGCTGCCATAATGGACATAGTGATAAAGGTTTCGGTTGCTGA
CTGGAAAGTTATGGCATTCAGTAAGAAGGGAGGACATCTGGAATGGGAGTACCAG
gtacctaacaccactgaggatttaaaatacggttcttcctctcccagtctgaccaaactt
attgattgggtggaacgaaattactactacttggggctctcagcttgttctctgtgcttt
tataaatttgtgattttaaatggtattttatgggttggaactatataactactgcttgaa
EXON 6  163 bp
ttcttcctctcccagtctgaccaaacttattgattgggtggaacgaaattactactactt
ggggctctcagcttgttctctgtgcttttataaatttgtgattttaaatggtattttatg
ggttggaactatataactactgcttgaattatttaagaccttttttccatttttgtttag
TTTTGTACTCCAATTGCATCTGCCTGGTTACTTAAGGATGGGAAAGTCATTCCCATCAGT
CTTTTTGATGATACAAGTTATACATCTAATGATGATGTTTTAGAAGATGAAGAAGACATT
GTAGAAGCTGCCAGAGGAGCCACAGAAAACAGTGTTTACTTGG
gtgagtaaatgtatcttatctaacgatagtacacattgacatctagattttcttcttaca
ttgttccttcctacttcaggagtgcctgtagtagttttaaatcctaatatcatctctgat
gtacgttgcccttgagatttatacttcgatttccattcctgctacttttccatttgtcca
EXON 7  141 bp
ccctccctgtttttgttgaataaacattgagtttatctttgagtgcttcaagcatgtttc
ttctttgacaagagttttgtggtgtatgtagaaataactggaattaatgtaattttattt
aattaaaaaaacctttttaaaaaaatcaatgcataattgacaatgttctggttgattcag
GAATGTATAGAGGCCAGCTGTATCTGCAGTCATCAGTCAGAATTTCAGAAAAGTTTCCTT
CAAGTCCCAAGGCTTTGGAATCTGTCACTAATGAAAACGCAATTATTCCTTTACCAACAA
TCAAATGGAAACCCTTAATTC
gtaagtgaattgtaaacttttctaaatactgttagtgttcagagacctaatcctgactgt
ctttgccctagttttgaatactgcagagataagaactgttatatactttatattttattg
ataaaccatgatggtatttcagatgttaataatgaatttttattttcatttagagcatca
EXON 8  123 bp
tctctgtaaaactgtgcttttcaaaggcaagagctctgggccatttgtttaacttatatg
tttgaattgaattatggttgaatatcagtttattcaattaagcacgtgcatttttattca
agtcataacagttcagacttaagaaatattattattaagaaaataataattttcttttag
ATTCTCCTTCCAGAACTCCTGTCTTGGTAGGATCTGATGAATTTGACAAATGTCTCAGTA
ATGATAAGTTTTCTCATGAAGAATATAGTAATGGTGCACTTTCAATCTTGCAGTATCCAT
ATG
gtaagtgaaaatactgagttttatttattttattttttaatttgaaattaatagaattca
aatgaagaaaagtcgattagagtatagacaataaaacatcttgggagacaatttcatgaa
tgattactaagcatacaagctccaaagttaggttgccagggttcagatcccatttttgcc
EXON 9  221 bp
ctatatttacgggagaaaaatgagacaaattaagatgtttaaaatacgttaaagaagaga
gacaaaacttaaaaggaattaatgtgataagtcacaggaaaatggataaattttaatagt
taaagacgggcctatttttgattacctttaaaaaaaacgttttaatgtttctatttgaag
ATAATGGTTATTATCTACCATACTACAAGAGGGAGAGGAACAAACGAAGCACACAGATTA
CAGTCAGATTCCTCGACAACCCACATTACAACAAGAATATCCGCAAAAAGGATCCTGTTC
TTCTTTTACACTGGTGGAAAGAAATAGTTGCAACGATTTTGTTTTGTATCATAGCAACAA
CGTTTATTGTGCGCAGGCTTTTCCATCCTCATCCTCACAGG
gtaagaatcatggttgcttactgtctggtttccacttccccacctcctatttgcttctca
acccatcacagtctggcttccatccctactgctccaccaaagctactcttgccaaagttc
tcagtgatcttccttgtgttaaatgtaatggacatttttcagtccttatctaactgaacc
EXON 10  113 bp
gaagataaactttttttcttttataataaagcaaaatgctgcactttgttttcataatgc
ttttatttttcttgatgctacttatgtatttttcagtgttgtttattttataacctaaaa
ttgttagctaacttcagttcagctttgtactggtagtgattttgtttttcaccttatcag
CAAAGGAAGGAGTCTGAAACTCAGTGTCAAACTGAAAATAAATATGATTCTGTAAGTGGT
GAAGCCAATGACAGTAGCTGGAATGACATAAAAAACTCTGGATATATATCACG
gtaagagtcttataaaatacaaccatctgaatcaaagaagaaatgacctaagatcttgtt
taactttttttttaatgtgtggatatctagaaaaataaaacataggcttaaccctcaata
aataaataaattcaggtaacttaaatgtattaaaagtggtatataccctaagaaagataa
EXON 11  123 bp
ttgcttcatttatacaaacaggactaaaaatgctgttaatcaaattcaaaatatactatt
tattaagatgagttctatgagtttatacatttttatgtgtcataagattgaactgatttt
cacattaccacaaaatttaaaactgttgcaaacctttataaattttatctctttttaaag
ATATCTAACTGATTTTGAGCCAATTCAATGCCTGGGACGTGGTGGCTTTGGAGTTGTTTT
TGAAGCTAAAAACAAAGTAGATGACTGCAATTATGCTATCAAGAGGATCCGTCTCCCCAA
TAG
gtaatgggtggtaccttcagtaaacttgaaatcagcacagtgtgatctaatctcatgggt
aaaatatccttcttactgtactctgtaaacaccatagaaaacagtttcagacgtttcaaa
tcttaggttctaagtgctgccaattaaccagctgtctaaaagttgttatctctataggtt
EXON 12  150 bp
aacagccttcagtgttgtcttactttctctctttttcaggctaattttatttctttaatt
ttccttttttattggtatataatacatctacatattttaggggtataagtcatataattt
gtaaagatcaaatcagtgtaattggaatatccatcaccttaaatattttctctctttcag
GGAATTGGCTCGGGAAAAGGTAATGCGAGAAGTTAAAGCCTTAGCCAAGCTTGAACACCC
GGGCATTGTTAGATATTTCAATGCCTGGCTCGAAGCACCACCAGAGAAGTGGCAAGAAAA
GATGGATGAAATTTGGCTGAAAGATGAAAG
gtaactaactttgttacacatacacttaagctagttttttgcttgtgtgattacaatgtc
agttttataactttagggatttttttttttaaagaaaaggaacagcagagttctgttgtt
tcatgttttgaaaagttctctagccacttgtgaaattttggtttagattttgagaacata
EXON 13  781 bp
tgaatggaatgtgatgttctgtatctcacattgcatgtttttatttagtttgtatgttgt
tttgttgtcatttggtaagtggccttattacagttgaagctttttaaacagagggtgcag
ttcaggtacttgaatcaatatatattcactcttacccctttgtatttctcccacttttag
CACAGACTGGCCACTCAGCTCTCCTAGCCCAATGGATGCACCATCAGTTAAAATACGCAG
AATGGATCCTTTCGCTACAAAAGAACATATTGAAATCATAGCTCCTTCACCACAAAGAAG
CAGGTCTTTTTCAGTAGGGATTTCCTGTGACCAGACAAGTTCATCTGAGAGCCAGTTCTC
ACCACTGGAATTCTCAGGAATGGACCATGAGGACATCAGTGAGTCAGTGGATGCAGCATA
CAACCTCCAGGACAGTTGCCTTACAGACTGTGATGTGGAAGATGGGACTATGGATGGCAA
TGATGAGGGGCACTCCTTTGAACTTTGTCCTTCTGAAGCTTCTCCTTATGTAAGGTCAAG
GGAGAGAACCTCCTCTTCAATAGTATTTGAAGATTCTGGCTGTGATAATGCTTCCAGTAA
AGAAGAGCCGAAAACTAATCGATTGCATATTGGCAACCATTGTGCTAATAAACTAACTGC
TTTCAAGCCCACCAGTAGCAAATCTTCTTCTGAAGCTACATTGTCTATTTCTCCTCCAAG
ACCAACCACTTTAAGTTTAGATCTCACTAAAAACACCACAGAAAAACTCCAGCCCAGTTC
ACCAAAGGTGTATCTTTACATTCAAATGCAGCTGTGCAGAAAAGAAAACCTCAAAGACTG
GATGAATGGACGATGTACCATAGAGGAGAGAGAGAGGAGCGTGTGTCTGCACATCTTCCT
GCAGATCGCAGAGGCAGTGGAGTTTCTTCACAGTAAAGGACTGATGCACAGGGACCTCAA
G
gtctgtatttgtggagcatcacccttggggtttcaatctgacgttttgtgattcagagca
gtacttgcagtactctgaaggatccttaagagttggggagagtaaaagcatctgagagca
gaggtctgagaaagtagcctcgaaggggcctgctgcaagaataagaagtcttatgtctga
EXON 14  168 bp
gcagtacttgtctggcacagaaaaattgtcactattttcctgttagcccattttaaaaag
aaatatgcttgaaaatatctagtttgttgtattttttctttgtagtcttttaaataattc
tctttactttttcgcctccatgcacacccactgtacttttgtctgttgtattctttccag
CCATCCAACATATTCTTTACAATGGATGATGTGGTCAAGGTTGGAGACTTTGGGTTAGTG
ACTGCAATGGACCAGGATGAGGAAGAGCAGACGGTTCTGACCCCAATGCCAGCTTATGCC
AGACACACAGGACAAGTAGGGACCAAACTGTATATGAGCCCAGAGCAG
gtgagtttttcagacctttacttactagcacagcagcagatgtacctgatgaatctcttc
tcatgttttcattaaaatacccagtaatctaaaacccagtaagtctgaaaattatgaaaa
ctggcagtagtgttccagtagtggaatagtgacacagctaagatgtagtttctacaacct
EXON 15  102 bp
ctcttggtgtagtagtgaagaaaagagacttgggagattaactctttgctaacattttta
cacatgtacttgcatttaaaccaagaagtgactaagtaaactttgggattcaataatgct
gtaatatcaactgtactgtctctgtgttaatttttaaattttctttatgtgggatttcag
ATTCATGGAAACAGCTATTCTCATAAAGTGGACATCTTTTCTTTAGGCCTGATTCTATTT
GAATTGCTGTATCCATTCAGCACTCAGATGGAGAGAGTCAGG
gtaagtaccctccctactcaaaaaaaaagtttcaaacagaaaataatctaacatttacaa
aagagttttttaaagacttagttcttcttaataccagcagattggttaactaaaagtgaa
agaggtgatgtgagtaacacagagaggagttctagactatttgcttccatttaaagctca
EXON 16  63 bp
ttgatggagtgtacatctgtgctcaggaaacatatgtagttattaaatcaggaaaagcta
ttgataaattttccatttgatagatgtacaacctcttagtcattttgttagagtatcaaa
aaatattttcatgttgtatgtcaaaataaacttaataagtgatactttttttctttttag
ACCTTAACTGATGTAAGAAATCTCAAATTTCCACCATTATTTACTCAGAAATATCCTTGT
GAG
gtatgtgtaattctcatcttttatcttctttagaatcatctttagaacgtaagcggtcct
tagcagtcgactcagtttcccctattttacagatgaggaagccaaaggtctagagaggaa
agagacctgctcccaagagcccagaatttgttaaaaccaaacactggagctggggcctgg
EXON 17  1194 bp
gtctctggatgcttttgtgcattgacggcagagctgagtagttgtatcagagacttgaaa
actcgaatatggctcaaaagcttaaaatatgtacagaaatattttgccagcactgatttt
aaaaactgtacagtgatcaaacctggccgttttatcacaaaacaatttttatattttcag
TACGTGATGGTTCAAGACATGCTCTCTCCATCCCCCATGGAACGACCTGAAGCTATAAAC
ATCATTGAAAATGCTGTATTTGAGGACTTGGACTTTCCAGGAAAAACAGTGCTCAGACAG
AGGTCTCGCTCCTTGAGTTCATCGGGAACAAAACATTCAAGACAGTCCAACAACTCCCAT
AGCCCTTTGCCAAGCAATTAGCCTTAAGTTGTGCTAGCAACCCTAATAGGTGATGCAGAT
AATAGCCTACTTCTTAGAATATGCCTGTCCAAAATTGCAGACTTGAAAAGTTTGTTCTTC
GCTCAATTTTTTTGTGGACTACTTTTTTTATATCAAATTTAAGCTGGATTTGGGGGCATA
ACCTAATTTGAGCCAACTCCTGAGTTTTGCTATACTTAAGGAAAGGGCTATCTTTGTTCT
TTGTTAGTCTCTTGAAACTGGCTGCTGGCCAAGCTTTATAGCCCTCACCATTTGCCTAAG
GAGGTAGCAGCAATCCCTAATATATATATATAGTGAGAACTAAAATGGATATATTTTTAT
AATGCAGAAGAAGGAAAGTCCCCCTGTGTGGTAACTGTATTGTTCTAGAAATATGCTTTC
TAGAGATATGATGATTTTGAAACTGATTTCTAGAAAAAGCTGACTCCATTTTTGTCCCTG
GCGGGTAAATTAGGAATCTGCACTATTTTGGAGGACAAGTAGCACAAACTGTATAACGGT
TTATGTCCGTAGTTTTATAGTCCTATTTGTAGCATTCAATAGCTTTATTCCTTAGATGGT
TCTAGGGTGGGTTTACAGCTTTTTGTACTTTTACCTCCAATAAAGGGAAAATGAAGCTTT
TTATGTAAATTGGTTGAAAGGTCTAGTTTTGGGAGGAAAAAAGCCGTAGTAAGAAATGGA
TCATATATATTACAACTAACTTCTTCAACTATGGACTTTTTAAGCCTAATGAAATCTTAA
GTGTCTTATATGTAATCCTGTAGGTTGGTACTTCCCCCAAACTGATTATAGGTAACAGTT
TAATCATCTCACTTGCTAACATGTTTTTATTTTTCACTGTAAATATGTTTATGTTTTATT
TATAAAAATTCTGAAATCAATCCATTTGGGTTGGTGGTGTACAGAACACACTTAAGTGTG
TTAACTTGTGACTTCTTTCAAGTCTAAATGATTTAATAAAACTTTTTTTAAATT
aagtatgttgactcttattttgaggagttagtcccaaaatggtagattttctaatttata
aaatgggatcatagatctaggaagagtcataaacctatcctcaaaaaaacttcttcctaa
cccatttcagacaggtatctttttcatcatttcccaaagacttggcaggccctttcaaaa