Gene EDAR Variant 1
DNA : 94.90 KbNT_022171
mRNA : 4212 bp NM_022336
CDS : 1347 bp NP_071731
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  413 bp
acccatgcctgtagccatctcagtggggggtccttctacgaacaagctttgattaatgat
attttaatgctagtttagctttttagcactcccacgcctaaaggctctgatagaagcaag
gcccccacccctgcaaaaaaaaaaatccatgatttttacgcattccaacagatctcttaa
GGGGCAGACGGCCGGAGAGCCAGGTGTGCCAGGGACCTATGGCAGCAGGGCTGAACGTGC
CCGCTCCAGCCTCTCCAGTGCTGGGAGAGACCTCTAGATGGTGCAGGTGAGTTTGCAATG
AGGGAAAGCCCCTCGGCAAGGACTGAGTTTCCAAACTTGCAGACAGGGCAGGGAGCGGTC
AAGGAAGAGTTCCCGGGAAGCCCTTTAAACGGAAAGGAAGCGGGGCTAGTGTCAGAGAGG
TGTGCCAGGTCCCAGGCAGCCCTGCTGGCCCCTAAGGACATAGAGTACCTGCTTCTGAGA
GGGCTGCCACGGTGGCCACCTGTGAAGCCTGTCACCCAGAACTGGATGGTACCTGACTTT
CTTCATAGACCCATCTTCTGCTGGGACTGAAGCTGACCTCCAACAGAAGCCAG
gtaagccctggtcctttcctctggttttctaaactcttcagctgtggccgagacggaggt
gtcatgggctgggagagaggctgggtgcatttttgaaatgcatgtcatttttgggttgcg
tttgaacaagctttaccgattgcagtatgtctgcgctaccagttctaagacctgagattg
EXON 2  69 bp
agagtcagcccaagtggcatgggtacagcttcagcttcatgtctgcttttcttttaggat
gtatagtttcccctctgtttgctggaaggcaccttatatccagtggggttaaataaaggt
agccagacccccggctggggtgctaccgccagtgcccagctaatgacgcatgtctttcag
GTGAGCCCTTGGGAGAGGATGGCCCATGTGGGGGACTGCACGCAGACGCCCTGGCTCCCC
GTCCTGGTG
gtaagtggtctgagccccttacccccacagcaccctcatcctcatgatggttggactgtt
tcttggcctcttcagctgtaaaatgggaatgctgatcatagtccctcctccacagggttc
ttctgagggtgaaatgaaaccaggcctgcaaagcacagaactctgccccaggctgaagtt
EXON 3  123 bp
caggagccactggagacttagcagcagtgagcactcacaagcgggcaccttcccagaccg
agcccccagcagagcccccaccgcagggcacccccttcctatgtcaaccttggggtcttg
caggagtcacatgtgtttctaaggaggtacggaggccacaacacccccctttgttggcag
GTGTCTCTGATGTGCTCAGCCCGAGCGGAATACTCAAACTGCGGTGAGAACGAGTACTAC
AACCAGACTACGGGGCTGTGCCAGGAGTGCCCCCCGTGTGGGCCGGGAGAGGAGCCCTAC
CTG
gtaaggacccagccctcctggagcctggtgcgctctcaggggaggcctcctgcttgtggc
attgttgccctgagcctgccttgctgtgtgaggggatgccagggtatatcaaaccagccg
gtcacgctccctggacgttgagattgatggcaagagctgccgtgagcccaggaatggcac
EXON 4  182 bp
agcccagagcatgagctggttcctggggggttttgcagttaggacaactcaggaaaccaa
ggcccggcaagagtagcttctggagacagctggcacgtcactgcccaaggactgtgggcc
gagtccgtatggtttggctgctgcactcacctgtgtcccctgtcctctttccctggacag
TCCTGTGGCTACGGCACCAAAGACGAGGACTACGGCTGCGTCCCCTGCCCGGCGGAGAAG
TTTTCCAAAGGAGGCTACCAGATATGCAGGCGTCACAAAGACTGTGAGGGCTTCTTCCGG
GCCACCGTGCTGACACCAGGGGACATGGAGAATGACGCTGAGTGTGGCCCTTGCCTCCCT
GG
gtaagcacaggccctcctggcaaaccctggcatgctttctgcagaaaaccccgaggggct
acgggcaaggaccttgggaacaggggtcatggatactgcaggcctcggtgcagccgcaca
cctggccttggtcccatcccacaaggagcagcatccaggacggagagtcctggcccctcc
EXON 5  86 bp
ttcaagacaggctgaaaccccaaggaaactgagtggacagagcaggtgactgagtgggcg
tggcctcatgcccgacttgattgtgggcctgcagactggccaccgtgctctctgcaccag
tccctgcctgtgtgctgtccagctcacctgtctctgttttgtcttgtctctcccccgtag
CTACTACATGCTGGAGAACAGACCGAGGAACATCTATGGCATGGTCTGCTACTCCTGCCT
CCTGGCACCCCCCAACACCAAGGAAT
gtgagtgtctttgtccttccaccagcacggtatttgttcagcacggatccctttcactac
agagggtgtaggaaagagccggtcctggcacctggacaaggtgaatcacagtaacagcac
tagtgaaagtgctcctgtggcctgtccaggcaggtctatgaagggagggatgtttgccac
EXON 6  87 bp
aataacgatgactctttagggttcattaaacagtctaagaaatacaaatatttagctccc
ctcagccatcactgcctcaggcccattcatgatcatgaatccagatccatgagctctgtg
gcagcgtctttgaaggtggagcttctctggatcatttgagggactctattttccttgcag
GTGTGGGAGCCACTTCAGGAGCTTCTGCCAACTTCCCTGGCACCTCGGGCAGCAGCACCC
TGTCTCCCTTCCAGCACGCCCACAAAG
gtgaggagggtgctcaggtatcgatcacctggagttaggtggtactcggatgaaagctca
gaagaggagaggaaatgatcatgagtgatgattatggtgcgcttccccacctggcctcac
ctccctaatgtaattgaatgacatgttgccccccgtgcaggaagtcattatatctgcaat
EXON 7  126 bp
tctggcagccaaaaccagcgcggaggatttggttctcagtctaagcaagcacctcagatt
tcagggttccctgaaagcatcccaggggcagggccattgcttccaggggccggagtcctg
gagggaagaccagcagggatcctgagctctgggtcattcatgccttctctccacccacag
AACTCTCAGGCCAAGGACACCTGGCCACTGCCCTGATCATTGCAATGTCCACCATCTTCA
TCATGGCCATCGCCATCGTCCTCATCATCATGTTCTACATCCTGAAGACAAAGCCCTCTG
CCCCAG
gtgacggcccccatgcgccggtgccctgcttcctggactctccgtcaactccccctgtcg
gagagcctggctgctcactccctcctctctccccagcctgttgcaccagccacccgggga
agagcgtggaggcccaagtgagcaaggacgaggagaagaaagaggccccaggtctgtgaa
EXON 8  75 bp
caatgtccaccatcttcatcatggccatcgccatcgtcctcatcatcatgttctacatcc
tgaagacaaagccctctgccccaggtgacggcccccatgcgccggtgccctgcttcctgg
actctccgtcaactccccctgtcggagagcctggctgctcactccctcctctctccccag
CCTGTTGCACCAGCCACCCGGGGAAGAGCGTGGAGGCCCAAGTGAGCAAGGACGAGGAGA
AGAAAGAGGCCCCAG
gtctgtgaaccagggcttccacacaccatgtgcacggtgcccatctctgggtggagggcg
ttcccagaagcagcctcctcgctgcttctgctctcacatgctgaaccatactgtgcttac
cgtggggtggtgccacacagacaccgggcagctctgcccaacaggaagagcagggttggg
EXON 9  73 bp
ccagaagcagcctcctcgctgcttctgctctcacatgctgaaccatactgtgcttaccgt
ggggtggtgccacacagacaccgggcagctctgcccaacaggaagagcagggttgggctg
agcgcagagccatgagccaattctaactcctatctccccaacctccccatttccctgcag
ACAACGTGGTGATGTTCTCCGAGAAGGATGAATTTGAGAAGCTGACAGCAACTCCAGCAA
AGCCCACCAAGAG
gtatgtggaagcccccagcaccaagctgaagctggggtcctgtggatcctgagcagggag
gggaaccagggtgcagccgagtgaactgacaggctagcctgggacactatggggacgttc
ggcgacagacagtccccaccacctctttgctgactggcaggggtcaggtggtgtgaggag
EXON 10  160 bp
gtatgtctcgtctcatgtcccctggtcccgtgcccacaaggtgcccagtaaacacctgaa
aaacaagtcattgccccccactgtccacagctgggcaatggacaagttcaccacaggaga
acttgtcagggctgcagcccccccaggcactgctaatgaccatcgctcttgtttttgcag
CGAGAACGATGCCTCATCCGAGAATGAGCAGCTGCTGAGCCGGAGCGTCGACAGTGATGA
GGAGCCCGCCCCTGACAAGCAGGGCTCCCCGGAGCTGTGCCTGCTGTCGCTGGTTCACCT
GGCCAGGGAGAAGTCTGCCACCAGCAACAAGTCAGCCGGG
gtgaggctcctgcaggtgccatgatgagctgtgagatgtggctccctcacagccgcaaga
ctaaaactttcttattgaatcagctctcctgcaagacggggtgtttctcccagaagtcca
agataggagacctggacagtgacaagttcacagcaagatagtcaaaagggaaaaaaaccc
EXON 11  61 bp
ggaaaacctgaagaaggccctcctccctgtgtgtcagggctgggctgctgacacgggggc
tgtgtgcagcgtctctggtgttgggcgtagctgctgcctgcccctgctgacatggaggat
ttgcctcctttctactgttgcccctttctggagatgaaaattctcgactctttttcacag
ATTCAAAGCCGGAGGAAAAAGATCCTCGATGTGTATGCCAACGTGTGTGGAGTCGTGGAA
G
gtaagctgaaaaaaaagcctgggagaggtggtgcccaccccaccgacatgaagggctggg
cccggagccctgaggctcctgtgaggggaactgagggaagccgcccatccagttgccgca
ctttggtcagaatggccgctggaaactatttcaggtgtggggaaacagaatcttgttccc
EXON 12  2757 bp
cagcgttctaggtgtcgtttgccttaagttatgcatttgttttaggtggctttctgcatg
ttttataattttaaaaaaatttttttcaaataatttttatttcatttaaataatttttca
gtgttgaccttctattgactgtgacttgcaacatctaactgtggccattggtgtctgtag
GTCTTAGCCCCACGGAGCTGCCATTTGATTGCCTCGAGAAGACTAGCCGAATGCTCAGCT
CCACGTACAACTCTGAGAAGGCTGTTGTGAAAACGTGGCGCCACCTCGCCGAGAGCTTCG
GCCTGAAGAGGGATGAGATTGGGGGCATGACAGACGGCATGCAACTCTTTGACCGCATCA
GCACGGCAGGCTACAGCATCCCTGAGCTACTCACAAAACTGGTGCAGATTGAGCGGCTGG
ATGCTGTGGAGTCCTTGTGTGCAGACATACTGGAGTGGGCGGGGGTTGTGCCACCTGCCT
CCCAGCCACATGCTGCATCCTGAAAAGCATGCCTGTGGGCTGTCCTCCCAGGACAAGCCA
AGGAGCCAACGAGGGCTCTGGAGCTGTGAGTGGTGCCAAAAGACTGCCAAGAATCAAGGC
TTTTGTGATATGTCACCGTATGCCTTAGGATGTTCAAGGAGCCAGACGAAATAAGGCCTG
TCTTCCAATTTAACCAAAGATAAAGGACTAGAGCCGGGATACTTTCAGATGCTCGCCTGT
ACCTCACCAGGCAGAGTAAATATCTACTCACTCATACAGCCAGCCCACCAGCCCACCATT
AACTCACTGAACAATGAGACAATGTTGAGGACTCAAATGAATCAAACCCCGTGGGAATGA
CAGAAGTGAAGAATCTGGTCCCTGTCTTTAAGGAGTTTGCACTCCAGTAGAAGACAGAAG
GAACGTATGTTTACAAACCACTTCACTGGAAGACGTCAAACAAGCTGAATGAAGGGGCGC
TTAGAAAACGTTAATAGAAGTTCTAAGCGGGAGATGACTCCCTACTGGGATGATGAAGGA
TGGCATCCTAGTGAAGAAGCAGCTCAAACATTTTGATAAAATGGCAACAAAATGCAGACA
CCCTGCTCCAGGTATTATTTCAGGTTTAGTACAAGTCTGTTAATACCCTATGTGGTTTCA
TTAGGATAACTTTTTACCTATCCTTGAGGTCATCCATATTCTTACAGGCCTTCCAGTCAA
TAATGGAAGAGCTCACTCTATACAAAACCAATATGCAAGGCATGTGTTTGTCCAAGCAAT
TGGATGTGTGCAGTAGCCAATTTCATTTACTGCATTACTCTTTGGCCTGGGAACCCTGTG
GTCTGCACTACATGTGAATGGCCTTCCACTTCAGTCTTAGGCAGATTTGACCTTTTAGGG
GCAGCAATGCTGAAGGACACAGCAATTTAAATTATAATGTGTCAGGCTGTGTTTTCACTT
CAAACATGTATGAGTAGTCAGCTGTAATTAGAGAAATGATGACTTCCTAAGAGTTCAGCC
ACGCATAATTCTAGATTTCAAGAGCATCTAAGACTTGTGGATTAGCCTCATGGCATGAGA
GTTTCAGACTCAGCCTTCTGAGCCAGTCAGGGAAAGTGGAGTTCTGCAGCGCAAATGAGA
GCCTGGGCTTGATGTCGAGGGAGCTGGCTTCTAGTTGTGCCACCTTGGGCCTTGTCTTTT
CCTCTCTCTGCCTCAGTTTCTCGTCTGCCAATGAGATGTTAGTTAGTGATTCTATAATTG
GGGCAGGTAGGGTTCAGGTGAGCAAAAAGAAAGTGGAGCTATAGGAAATGCCAGGCCTTT
GAGGTGCTCTATGGAAGTCAACACAGTGTGGTTTGTCCATTTAAATGGGAATAAAAACAG
AAAAACTCAGACTTGGCATTTTCACAATAACTGCAATGGTTTGACATAACATTTATAGGC
AGAAAGTTAATAAACTGGCATTGTTCTTGGCATATTATTGTACTATCCCTGTAACTGCCA
AGAGCTCAGGAGCCAGGCTAGTGATCACACCAGGGGTTAGAGTTCACTGCTGAACTCCCT
GATGGCAGGTCTGTGTTTATTACTACATTAAAACAAAGTCTCTGACTTATAAAGCGAGGT
TGTAAAAATTACAAGTTGCATGACTGAAAAAATGCTTTAGGGGGAAAATCAGTCATATCT
TTAACACCAACAAGCAATTTCCCACCAACGAATGTAGTACATACTGTGAGAGGATCATAA
TGAGGTCCTGAATATTTAATATCATCATTTACTGTGTCTGTTTGCTGCTGTTTTTCGAAC
CTATTTGGTTTACCCTGCAAGCTAAATACTCCACGGCAGAGCTTAATTATCCTTTTAATT
CCTCTTTGAAATCCTGTGGTGCCCCCTTCCCCCTGCCTTGTGATGATGATGAGTGAGTCT
CCCCTTAATTAGACTGCAAATGTCACTTGTGATGAGTGTGCCATTCCAGGATAACAGCTT
GCACCCTCCTCAGAATGTTTTCAGCGAAAGAGTGGGGTGGCTGTTCTCTGCTCCTGGTGC
TTTGGCCTCATTTCACACTATTAGAATTCTGGGGCTGTAAGGCCAGCCAGTGTCAGCTCA
TGTTCCATTGGCTCTCCACCTGCCATTTTTAGGGAGCTATTCCTTATATAGTTACAAATT
CCCTTGTCATTTACTTATTTGGAAACATGGGATTTACTCTGACAAGCTTTAGCCTATGTT
ATGGGATTCAGAACAATGAGATCATAATAATTCTCACTGACCAAAGCTGGGACTCCATCC
TGCCATTTTTGTGTGGAGATATTCATAATTCTGCAATACTTTAAAACATTTAGAAAACAC
CCCAGGGTAGGTCTGTGGCCCTTAGACAGTGAAGTCTTAATTGTCAATATTATTTTTGTC
TAATTCTGTATATATATAACTTATTATATTTTATAATCTCAATAAACACATTAATAA
gatttatagactaccgtaatgtgagctctctttgtatttggggtggtgggtcggggggtg
agtggggaaggttctgattgctctgttcctggttattgccctatgtatgatgagactgta
ggattgcaaccagctataaacaaagtgcctaaaatgttatggcctgggacattcactagg