Gene DUSP2 Variant 1
DNA : 2.26 KbNT_026970
mRNA : 1676 bp NM_004418
CDS : 945 bp NP_004409
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  474 bp
cgcgccctgccttccccctcaacctcccccccgccccgaagtctccaggtcagcccagac
tgcgccccacgtgaggggcgggggcgggcgcgggcgccagcgccttcctgctctgccctt
gtatggtgccccggaggccggcccacgggtacttaacccgggccgccgcggagggcgccc
GGAGTCGACCGCTCGGGCAGCGCCACCGCCACGAGAGCCCGGGACGCGGGAAAGACCGAA
AGGAAGAGGAAGAGGCACCGGTGGCCATGGGGCTGGAGGCGGCGCGCGAGCTGGAGTGCG
CGGCGCTGGGCACGCTGCTGCGGGATCCGCGGGAGGCGGAACGCACGCTGCTGCTGGACT
GCCGCCCCTTCCTGGCCTTCTGCCGGCGCCACGTGCGCGCCGCGCGGCCAGTGCCTTGGA
ACGCGCTGCTGCGGCGCCGCGCGCGCGGCCCTCCTGCCGCCGTTCTCGCCTGCCTGCTGC
CCGACCGCGCGCTGCGGACGCGCCTGGTCCGCGGGGAGCTGGCGCGGGCCGTGGTGCTGG
ACGAGGGCAGTGCCTCGGTGGCGGAGCTCCGGCCCGACAGCCCGGCTCATGTGCTGCTGG
CCGCGCTGCTGCACGAGACCCGCGCGGGGCCCACTGCCGTGTACTTCCTGCGAG
gtgagcaagccggccgcccttggcccgccccacccgactccagcccggctttccctgctg
atcgtgctcttcccctccttgcaggaggcttcgacggcttccagggctgctgtcccgatc
tgtgctctgaggcccccgcccctgcgctgccgccaacaggggacaaaaccagccgctccg
EXON 2  122 bp
tggcggagctccggcccgacagcccggctcatgtgctgctggccgcgctgctgcacgaga
cccgcgcggggcccactgccgtgtacttcctgcgaggtgagcaagccggccgcccttggc
ccgccccacccgactccagcccggctttccctgctgatcgtgctcttcccctccttgcag
GAGGCTTCGACGGCTTCCAGGGCTGCTGTCCCGATCTGTGCTCTGAGGCCCCCGCCCCTG
CGCTGCCGCCAACAGGGGACAAAACCAGCCGCTCCGACTCCAGGGCTCCTGTCTACGACC
AG
gtgagtattgacccccctcccccgaacctccctctctccccgccgcggactgggcgcctc
tagggaaagagcctgccatttggggatgcgagcagtttgcccatatacacacacttttat
acgtgtgtgtgttgggggagggggtggggcatggctgctcgcgcgtgcctgtatgggtct
EXON 3  220 bp
gcatgaagggaaatgtatgtcccggtgtgtcctccgcacattcctgagacctgtctcagg
tcaggaggactggctgaggagtcctcttgtctcggccagcccatggggtctccacccgct
gctgctccagctctccggggctgggctggaaaggcctcaccgcccctctgttccctccag
GGTGGCCCTGTGGAGATCTTGCCCTACCTGTTCCTGGGCAGCTGCAGTCACTCGTCAGAC
CTGCAGGGGCTGCAGGCCTGTGGCATCACAGCCGTCCTCAACGTGTCCGCCAGCTGCCCC
AACCACTTTGAGGGCCTTTTCCGCTACAAGAGTATCCCTGTGGAGGACAACCAGATGGTG
GAGATCAGTGCCTGGTTCCAGGAGGCCATAGGCTTCATTG
gtaagggggcacctctgcccagaaatcccgaggggctccagaggagaggactgggggcac
ctgtctcctgggctgtgcacattccgtctgacaccactcccccatctcccttgcagactg
ggtgaagaacagcggaggccgggtgctggtgcactgccaggcgggtatctcgcgctctgc
EXON 4  860 bp
cctgtggaggacaaccagatggtggagatcagtgcctggttccaggaggccataggcttc
attggtaagggggcacctctgcccagaaatcccgaggggctccagaggagaggactgggg
gcacctgtctcctgggctgtgcacattccgtctgacaccactcccccatctcccttgcag
ACTGGGTGAAGAACAGCGGAGGCCGGGTGCTGGTGCACTGCCAGGCGGGTATCTCGCGCT
CTGCCACCATCTGTCTGGCATACCTCATGCAGAGTCGCCGTGTGCGGCTGGACGAGGCCT
TTGACTTCGTTAAGCAGCGCCGGGGGGTCATCTCCCCCAACTTCAGTTTCATGGGGCAGC
TGCTGCAGTTTGAGACCCAGGTGCTGTGTCACTGAGGTGGTGCCCCTCTGCCTGCCTGCC
CCACTGTGCTGGCAGGAGCTGACTGTGGACTGGTGGGCTCCCCTCTGGGCCAGCACAGTC
CCCTCACCTCTGGCAGGGCTGCTACCTCCTCAGAGTTTCAGAAGCCCCCACATGGGGGCT
CTAGGAATGCCGGCATGCTGGTCTTTCCGACCTGGTGCTCTTCTGCTGGGGGACTGAGGC
TGGCCCTCATTCGGGGTCGGGAACCAAGGGTGTGTCTGCTCTTTCCCTCCCCATCCTCTG
GCAGAAATCAGCTAGACGCTATACCGTGGACTCTCCCTGGTCCACCACCATGTTGAAGCC
CTTGGCAGCCTGAGAGCTCCAAGGAACAAGCTGTGACAACCAGGAGCCCTGTCTGTGGGT
TCGTCTGCCCAGGGCCTGGAGCCCAAGCCCTGTGTTCCTGGGGAAGCTGGGGACTTGGGA
AGTGATGGGTGTGTCATGTTGCGTGTGTCTGTCTGTGAGCCTTTCACACCTGTGCTGGCG
CTGGAAAATTATTTGTGCTCAGCTGACATTTAACACTCCCTCCCCCGCTTCCTCCTAGCC
CTGTGGGCAGGGGTTGGAAACTTAGCACTTTATATTTATACAGAACATTCAGGATATGTC
AATAAAATATTGTTATATTT
aaaaaacaacaacccagcatctggtctcatctgatacccgggagcctgcttggacctcac
gtttccttgtgcccttggggtttgggaagtgaatgggcagaggggccagcggccggaagg
ggcaggtctgaccctccccacaaaggctgctctcttggccccagttctccctgggctggc