Gene DTNB Variant 2
DNA : 296.30 KbNT_022184
mRNA : 2387 bp NM_021907
CDS : 1884 bp NP_068707
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  164 bp
gcgcggccgcgggggcggggtggaggggggttgctcggccgctcccgccccctccccgcg
cgcggaagccacgcccccggccgcgcgctcgcgctgggcgcgcgcccgcccatccgccct
ccgccctccgccctcgcgccctcgcgccgggggcgggcgctgcgcgtgccgggcggagaa
GCGGCGCGAGCCGGGCGCTGCGAACGTTCGCCGCGGGGGTGGCTCCGGGGCCTGAGTAGG
CGCTGCCGCTGCCTCAGCCGAGGGGGCTGGGCCGGAGCGTGCGGAGGAGTGAGGCCGCAG
GAGACCTTCCCGACGACCCCTGCTCCGGCGGGGAAGTGAGCAAG
gtgggggtctgcggccgccgccggggctgtggggagacgagctgggctggagcctcgcgc
ccgcgaggtgcgggacggcagctcgcgctgcgccgggactggggacccgggagcctgcgg
gtgcggcgctgcaggagtcggggagggcgcggggagccggggccgctgcaccgcgcgcgg
EXON 2  68 bp
caaataaaaggatggcagtttatctttttctgaatcaggcttccagtttatttttactga
tactgtcttaaaatgtgcatttgcaacttggtttccggtccctcttcacaatagaatgat
tagcacttgattgaattgtcgaattatacagtggtttattgtatctttctttgtctctag
GATGATTGAGGAAAGTGGGAACAAGCGGAAGACCATGGCAGAGAAGAGGCAGCTGTTCAT
AGAAATGC
gtgagtcttgagtccttgttcatatgtgcgggaatgtttgtgtggttttttttttttttt
tagatcaagtcatagctttaatcagttacaacttttatgttataagctttgcagagggaa
gaatgggagttaaagaatcatggagttgaaggaccccaagccaaagcatatatttgaata
EXON 3  81 bp
ctggagatgcacgtgtttcctatccttttctccctctgttgttgttttaattgacccacc
gtttttaagaagtcctagctgactggtatactatgacaatacaatagaatggagtcattt
cctagcgtttggaaactaaatggtaaatctagttgagcatttctgtttgccttttttcag
GTGCTCAGAATTTTGATGTCATACGACTATCAACTTACAGAACAGCCTGCAAATTACGAT
TTGTACAAAAACGATGCAACC
gtgagtcatttctactcatttctgtgatagctggatagagttctcaatattagaaaagac
tttaacatcttttagttgtattgtaatgttaattgaattatttttgtcttaagtatttat
tagtatgtaagctttgtaatggaagaacttgtcattttacttctttgtccttcaaaatgt
EXON 4  214 bp
gctccttgatgttgtctgggactgatgttctttatttgaccacagaatgttttcctcatt
gttggctaaagagtttcttctctttaaacttaagaactagttgataaattttagattcct
attgtgaagggtagtaccacactttaaaattgttgacagtttattttctttgtcttttag
TTCATCTTGTTGATATCTGGAACATGATTGAAGCCTTCCGAGACAATGGCCTTAATACAC
TGGACCATACCACCGAGATCAGTGTGTCCCGCCTCGAAACTGTCATCTCCTCCATCTACT
ATCAGTTGAACAAGCGCCTTCCTTCTACTCACCAAATTAGTGTGGAACAATCTATCAGCC
TCCTCCTCAACTTTATGATTGCTGCATATGACAG
gctagtagtaccttaccttacacgcttacttcattttaagaacacctgtctctgaatcat
tcttcttccatactgccgtgctaagttgccttgctaagctggcaacttagaatcatgatt
aaaagggaaattattggctgggcacggtagctcacagctgtagtcccagcactttgggag
EXON 5  86 bp
gcataggtgaagtcttaattctacaaatgaaaaaaaaaaaatccagggtttctaaatgtg
gtaaaattgtaacagacaaggtcaggaatcaacttactgggttgctcagtatttagtgat
acattcgagtccttttgtggtttcagatagcaattatttctaatataatttattttgcag
TGAGGGCCGAGGCAAGTTGACGGTATTTTCAGTTAAAGCTATGTTAGCAACCATGTGTGG
TGGAAAAATGCTGGACAAATTGAGAT
gtaagtattttcatattatttgaaaaatgccattttcaaattaggacttttaaatgaata
ttgtcagaattttgaatgatgttatattgagcttttaaaaaaattaccatgtcactcacg
ctgcagcagctggctcacagtaggtgagttatgccacctactgttcagatggaaaagttg
EXON 6  155 bp
gcagggtagccacacagtgttaataaggatgagaatagttttaatattaactaaaagtca
caataattttatgatacttttttaatgatactttttgtttggtatacaaatgacatagag
ccatttataaaaagctgatatttccttatagcttgactttatttggttttgttctcatag
ATGTTTTCTCCCAGATGTCAGATTCCAATGGCTTAATGATATTTAGCAAGTTTGACCAGT
TTCTGAAGGAAGTTCTGAAGCTCCCAACAGCTGTCTTTGAAGGGCCATCTTTTGGTTACA
CAGAGCACTCAGTCCGCACCTGTTTTCCACAGCAG
gtaaggacagttttatagaatctagggctagaagagcgctcttccctcccttcaccttct
aacagattttgccagattgcttccagtctagtaaggtcttgagtaggggaggaaaaaagc
tttaaaggtggtggggagtggatgaataaaagcggggggtaaaaattcacctgaaaactc
EXON 7  106 bp
aatagtagtagtgtaaagtacagcatgtagtagtgtctgtagtaatgtaaaatattttat
tttgctataaaatttaccgtgtaattcactaaagtttggatgggaaaaatcctaaattaa
acttggagtttggagattcctaaaaaacttaaagtatgtttgtttttcttctctttacag
AGAAAGATAATGCTAAATATGTTTTTAGACACAATGATGGCTGACCCTCCTCCCCAGTGC
CTTGTCTGGCTACCTCTCATGCACAGGCTTGCCCATGTTGAGAATG
gtaagcagaacttttattgttcaattccgcatgctatagaaagtataggaactgattatt
tgcaatgtccttagctattaatatcattgaaaattacagttgacatttgctgtcattctg
tcatttcattttgtggttttggctttcagaagaatttttttttaaaaaagggagggtact
EXON 8  167 bp
gggattacaagggcaagccaccgcatccggctctacttttatttttacctttgtttttat
attagttttggtattcctctgtattgacttcattctccaagtgaaattttattctttctt
cttttattctatcccttccctcctgcccttttttctccccttttctctcctgtccacaag
TCTTCCATCCCGTGGAGTGCTCCTACTGCCGATGTGAGAGTATGATGGGTTTCCGGTACC
GATGCCAGCAGTGCCACAACTATCAGCTCTGCCAGAATTGCTTTTGGCGTGGCCATGCCG
GCGGCCCTCACAGCAACCAGCACCAGATGAAGGAGCATTCCTCTTGG
gtaactgctttgtgtttcatctgtgtccctgagtgttaatctgtttgatcagtaacagca
cctgggccagtttcctcatggatgcctaccaaataagggtgtgatatagtaaaatcttaa
cactaacatttatgccaggattgcaaaaatgttgtgcttcctcacttgattttaaaagca
EXON 9  125 bp
agatgaccttggaacaactggaggttcctttctgaaaggcccaatgatattgatgtaatg
aaacttgatttgtatttgaaaagatgtttttacactcttgtcacaaagtttttttctttt
ttgaagttcctttcattcttttgaagggttaattccttactattttctgctttgacacag
AAATCTCCTGCAAAGAAGCTGAGCCATGCAATTAGTAAATCTTTGGGGTGTGTACCCACG
AGAGAACCCCCGCATCCTGTTTTTCCTGAGCAACCAGAGAAACCACTTGACCTTGCACAT
ATAGT
gtaagtatacccctggatgtgcatgtggatcacactgaaatgggggccttgtgaaattcc
tgtggatcaaaaccagggatcacttaacatgaccattcaacttctcaggtttttactttc
ttttgtgggaacttaagacttcaagctttcttctctgtaaatcaccgttaagtgtccaca
EXON 10  78 bp
catgggtccccacctccccatgggcctccccttccccatgggtcccccccctccccatgg
gtccgtctgtgcttaccgcgaatgatgattggtccctttgctcttaccatgcttatcgtc
gtttcccttgtttcccctagttggtcattattaatataaggtaaatgtcttttctttcag
TCCTCCTCGCCCTCTGACTAATATGAATGACACCATGGTTAGCCACATGTCCTCTGGAGT
GCCCACTCCCACCAAGAG
gtacgtatgtcttgtgccttcgacttgggtgttggcctctgctactgatttgcgatgccc
ctgccagaaatgaggcctgaaaagcaggttgttccacagggcagaaaggactggtttgct
ttctcttcctttgaccgtcttttagtcttaatttctactttttattttccttttttcccc
EXON 11  90 bp
ggattcctgaggatctaacaccatattccattatgcattgtgggttttttattgttttcc
ttatcatgatttattattttttaaatttttctttgaagtttgctcattttaatccatgtt
catttctccctctgtatgtgtttgtgtcacgcttgctgtctttgcctccattgttcctag
GTTACAGTATAGCCAGGATATACCCAGTCACTTGGCCGATGAGCATGCGCTGATAGCCTC
CTATGTGGCCCGTCTGCAGCACTGTGCACG
gtcagtggtggtgcagcagcagtgggtagccacgggtgatcagagggagggagagctttg
ctacctggggttgtcagctggaaaaaaaactgcatgtcaggtttttcttgagcagctacc
agctatgtttggcagagttaaaatagttgctaagcattagcttctacaagagagggaggc
EXON 12  88 bp
ggcctcctcatttctctaaatcccctttttttcagaagaccattagtatctatgacccag
gcctctagttcttttattaccattcttttatgagcttttcttccatctgttctttctgag
aatggaacaagaataagggatgtttaatagacacttgttgcatttttatttccttggcag
TGTTCTGGACAGTCCTAGCCGACTGGATGAGGAACACCGTCTTATAGCTCGCTATGCTGC
CCGGCTGGCTGCAGAAGCAGGAAACGTG
gtaagttaatggaggatcccaggagagtagcagaaattagcattactttaatatgcaaat
ggaaagggaatagtagacatgaaatttaggagaacaggtacctcggggacactttccact
tttccacatgctaagagtagaaggaaacttcctcaccctgataaagaacacctacaaaaa
EXON 13  86 bp
gtgattggttgcacaactgtttaaatttactaagactcattgaattgtatacttaaaacg
ggtggatttatgatatgtaaattatatgtcaaaaatcttttttaaaaatcagtcaatcta
gaactctgggtatatttggatcagaaaaaaaaaaactttctcccgacttccccactttag
ACTCGTCCTCCCACTGACTTGAGCTTTAACTTTGATGCCAACAAACAACAAAGACAGCTT
ATTGCAGAACTGGAAAACAAAAACAG
gtaagaacgcagaggctgagcccacttccagagtccaggattatcacgtgcgtatctgat
tctcattttccttggatactaggtggcttttgaccgccaaggaagaccttgcctcagtga
acctaggctagcccaagtccagggaatgccctggacgctgatttgtgtctgtctgcatgc
EXON 14  114 bp
aggaaatgtcaggtgaagcagtattgagaaggtgtccatttcacctcttggccatttgga
agcaatcaaaacaagattggtagaggaggcactgctagagttgaaaagttgtaataggga
aagagggagcgtgagtgagaagcactgtgcagcccctttccgttcacccatcctctctag
AGAGATCCTGCAGGAGATTCAGCGTCTCCGCCTGGAACACGAGCAGGCCTCCCAGCCCAC
CCCTGAGAAGGCACAGCAGAACCCCACGCTGCTGGCAGAGCTGCGGCTGCTGAG
gtgagtagggacactctaccacttgccacatgtaatctactatggatggaacttatctga
ggaaaccaaaggagtggggtagaatctgttgttcagtataaacaatcctgtgagcgcaga
ccactgaagagttcacccattctgttgctgcttcagatgtctgggttccattagagatca
EXON 15  97 bp
acagtccaggaagtaggcaaaacagacattatcaccattttatgaggtattggatgctaa
atgacttgctcagcgtctcataactggtaagtagcaggatcaggtctgaaatccatttca
cctggccttagatccatctttgagggtctctttatctgataggcttctcgtcttggatag
GCAAAGGAAGGATGAACTGGAGCAGAGGATGTCGGCCCTGCAGGAGAGCAGGCGGGAGCT
GATGGTCCAGCTGGAAGAGCTGATGAAGTTGCTGAAG
gtaagagcccgtggcccacgctcagttcttgtcattcttctcccaccacagcctcagctg
ctgcctccctgtgatgtcagaataggatgaggccaaaggcttgactttagcctagaatca
gttttcagataaatttagcctaattgggtataaaagtcatctaaattagtgcaaagccag
EXON 16  21 bp
tgcttcgtcctctgatgctcctgtgggggatggggcctttgatctcagcacctgtgggcc
tggcctggtttgcctgatttttctatcatttctgaccaatgtttgtggtgatgggcatta
atgggcattaatttctctccttttttcctctgcctttttttttcatcttcaacactccag
GAGGAAGAGCAAAAGCAGGCA
gtaagtgaacttcggaatttcccgccggactctcgctcctttgcacgttcttcctttcct
catataaatgtttctcctcttctccccgcacatcatctctgaagagggttttatgtgtaa
aacccccagcggttctccccatggtgttgtaaaatggcctaaaagttcaaggcatgttta
EXON 17  160 bp
ttccttttcttcctctctccagtcttggaagcagcctaactccttcctttcaagtatgat
cttgtaccactgaactgaggcccactggctggctctggttgatggagaaaaagtactttc
ttccttcctcaaagaggtcaggtacttgagataacgtattttctgtctttgaatctccag
GCTCAGGCCACAGGGTCACCACATACATCGCCCACCCATGGAGGCGGCCGGCCAATGCCC
ATGCCAGTGCGCTCCACGTCTGCCGGCTCCACCCCCACCCACTGTCCGCAGGACTCGCTG
AGCGGAGTCGGGGGAGACGTGCAGGAGGCCTTCGCACAAG
gtgagtttctggagcagagttcagcggggagctgaagggatgtgcaaacacggacaagat
tcctgctgaggttttttccatttctgttttgtgctctttgcttggaatgatcagattttg
acagacagtgtaaataagtcaggtgctggccccttctcatgagacgggctggtctccagc
EXON 18  90 bp
gtgggctggtgcctcctgcccccggtgtgcctgggaatgggtggagctgctgtggcccca
tctccccttaggtgttccacacctgtgttctcgggcctggcagaactgaggcatttgctc
agccgtctcttctccacgctcacccaccctggcatccccatctgctctgcctctcctcag
GTACGAGGAGAAACCTCCGCAATGACCTGCTGGTGGCAGCTGACTCCATCACCAACACCA
TGTCATCCCTGGTGAAGGAGCTCCATTCAG
gtgaaacccagagctcccagccagcttcctggcctcccctgccttgcccgcgcccttctc
acttccttgccagcaccggcagaacctcaccacccagcttgcaccaccccatttcatcac
ctaactttgccttctaggaacacactggatgtctccacccagagagcctctgtcacacag
EXON 19  54 bp
cagtgctggggcgtgggccgcacaagtgcagactggtgagctgaagcaccctcagaggcc
tgcagccaggagctgttagctagagtttcctcccaagcctcagcagttgctttgttcacc
ctccttctgtacttgtcctgtgccgaagggtcactggcctccttggacttgttttcacag
CAGAGGAAGGTGCAGAGGAAGAAGAAGAGAAGATGCAGAATGGGAAAGACAGAG
gtaaaggcagctcagcaggactgctcgtttaaatggggagcccgagctcatggatcagcc
gccccccactttgtttctgcattcctccctgccaccacctttcccagagctttcggaccc
gaggtccctgtacctacttttcccatctgacagtcaggttttaccttccaggtgacaagg
EXON 20  34 bp
gtagaaagtatgactctaccctgctgtcatacctgggtgggaaaagtcaacaaacgagta
acgggagaagcaaggaagcccctggggtgggttggtcagggaagcccctttgagatagtc
tggggcatgagaagacctggccgtgacctcagtgtgttgtttctgcccatgctgccacag
GTTAGCAGAGGAGCCGGACACAGAGGAAGCTCAG
gtgagtacaaagagtcctctgcctccccacggcccctccctccttcctcagcatcttccc
ttcccctcccttcctgcagtcacaggtccctagccagggcagtcctaacaggtgaagatg
caagagcccaactgtcccttccctttgcccaccccagccatgtgccctccttgccctgtt
EXON 21  309 bp
ctgacccttaggaatgatggcagaggaccctaggtaccacccttcagcccaacgcttgaa
aggcgcccagcatcctagcagcccctccctgcagggcctcctgttcacagtagatgttag
cagcttttgtcctgaaccctcaacagtgcccgtgactaacggtgagtgtgtcttgcgcag
GCACAGAGGACGAGGAGCAAGCTGGCGCCGACATGGCGAAGGCAAGGTCTTCCCCCAGAG
GCACATTCCTCTCCATCTTTCCACCGCACACCTGGACCAGGCTTGCAGGCTGCCAGACGT
CACTCCACCCGCCAGGGAGAGGGGAGCCAGAGCCGGTGGGAAGCGGGGAGGGGCTGCGTG
GCACAGCTAGTGGGCCTCCCCCTGCACAGCCCTGCATGTACTAGCACCTTCATCACTCCC
CTCAGGGCATGGTCTCATCTCCGCATCAGGAATTCACCTGGAGGTTGAAAAGAGAAAAGA
AAAAGCACC
aagctcttgtgtgtttgtgacctgatgaaacacttcctggcgtctggccagcacgtgggg
tgctcctgaacgtgggggcacaagtttccttatctttgacctttaaaaaccaacaggttt
cttccagcgtgcaaagaaagcgtcaggccttgctcggctctgtagacattcacaccctgg