Gene DPP10 Variant 1
DNA : 535.12 KbNT_022135
mRNA : 4349 bp NM_020868
CDS : 2333 bp NP_065919
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  117 bp
tcccccaaaagatagccatttataatatgtgcacttttgaataattaaatgaactactga
agaggaaatggattctaatcagctttcaaactgtgattgtgccatgcactgaatcattcc
tttatgaatacatttctcttggagcatgaataattacaaaacttttttttctatctcggt
AGGAACTGGGAAGTAACAGCCCTCCACAGAGAAACTGGAAGGGAATTGCTATTGCTCTGC
TGGTGATTTTAGTTGTATGCTCACTCATCACTATGTCAGTCATCCTCTTAACCCCAG
gtaatctgtctttattcctctcttatgatggatggtattgtggatgataatttcgcattc
aaatgccttaagagggtagcaatatgtggtatcttagggcacattagcatgggttggaat
ttggaaaaaaagcataatcagacattttgcaaatggcacagtaattctgcagttcaaata
EXON 2  96 bp
tttcatttatttaaaaagtcattaaacaaagttcaaatgccaaaaaccatgtcaaaatgg
tcactttatattgttatgtagttaatatattttagagcaaatattccaaattttgtaatt
tgctccttttaaaaaacaagcataagataggcatctaacctagaatttcctttattttag
ATGAACTCACAAATTCGTCAGAAACCAGATTGTCTTTGGAAGACCTCTTTAGGAAAGACT
TTGTGCTTCACGATCCAGAGGCTCGGTGGATCAATG
gtaagtgtatacctttttaaacattgtattcattttgagttctgtataattaaaatttta
aaaaatgagatgtgtaagctgggcgcaatggcttatgcctgtcatcccagcaccttggga
ggccaaggcaggagaatcgcttgaacctgggaggcggacgtcgcagtgagccgagatcgc
EXON 3  95 bp
ttaggcgggcttcctgatctttcacgagaatgaatgccaagtacagaaatctgcttgggt
tattgaaggctaaaaatgattattctaatgtgtctgtttattttgcacgttttctcccct
acagttactatattatctagtcaatgtatttgtcaattgtgaatgtctttgttgttgcag
ATACAGATGTGGTGTATAAAAGCGAGAATGGACATGTCATTAAACTGAATATAGAAACAA
ATGCTACCACATTATTATTGGAAAACACAACTTTT
gtaagtaatgaataattaattactttatgcatttcagtactgtttagaaagctctctaga
tgtacataactttctattcttcagctccagcatttgtaaagcatttcaggtgaaaagttg
gggctggaatatcataagaatcagtaaatctattgataaaaaataccctgtgactatctg
EXON 4  75 bp
ttaagctttttatattcatctgaataatcatacatacatacatgcaaatatgtatacaat
ataaaagaaatgagaatgccattttatagtgctatgaaaattgatttttttttacattta
tacatccaaattcatgttaagaagtttttaaatataactggtttttttttctttttctag
GTAACCTTCAAAGCATCAAGACATTCAGTTTCACCAGATTTAAAATATGTCCTTCTGGCA
TATGATGTCAAACAG
gtaaaggagtgatcttctttgagaatacttttctttgtgatgcattggggtgacaatgca
taattttactcagctataactcacctaagcaaaatctggcatgtctagtaactaccggag
gacagtaatgactactttgcacaaaagatgtttgaagataatgtccaaacatcttccata
EXON 5  53 bp
agaaagaaaaattaggcataaggcacagagagggtgataaacttctgagctagaatgttt
tatattttcatttctgcctaacaccaattcttggattacctggatgttactaagaatata
tatacatatattcacattaagataaagctatgatcaataatgtttcttttttaatttcag
ATTTTTCATTATTCGTATACTGCTTCATATGTGATTTACAACATACACACTAG
gtaagttctttgattttctagttttcatgagcaattgtgttactaaattgttggtgtaga
tatcagtttgttcatgtaaaaatattcacattttttcaagggaagtttgggagttaaatc
ctccagaagtagaggactccgtcttgcagtacgcggcctggggtgtccaagggcagcagc
EXON 6  82 bp
tcaataatgtttcttttttaatttcagatttttcattattcgtatactgcttcatatgtg
atttacaacatacacactaggtaagttctttgattttctagttttcatgagcaattgtgt
tactaaattgttggtgtagatatcagtttgttcatgtaaaaatattcacattttttcaag
GGAAGTTTGGGAGTTAAATCCTCCAGAAGTAGAGGACTCCGTCTTGCAGTACGCGGCCTG
GGGTGTCCAAGGGCAGCAGCTG
gtaagcgcaggcattggtatgcactgaacactgccaatcatggttttatggaagatgtta
actgaaactttggaaaaaccataggaaaacttgtcctacaaaactttatgtttccctaag
tcctttatatcttttatctaatagtccaacttaagaatacattaaatgatactagtatta
EXON 7  121 bp
aataaaacagaaaaagccattaataattgaaagcaataaaaacatatgccttgaataaaa
acaacttgaagcccgtaaataatacaacatggctattcagtgatcattctgtaatattaa
agtttcaaaaggcatcctaacgtgttggattttttgtttgtttcacatttcctgatccag
ATTTATATTTTTGAAAATAATATCTACTATCAACCTGATATAAAGAGCAGTTCATTGCGA
CTGACATCTTCTGGAAAAGAAGAAATAATTTTTAATGGGATTGCTGACTGGTTATATGAA
G
gtgagttgatcagatttagtttcaaaggaaacaaatgacatatttttatacaaaatctac
caaaaaaaatctattcattccggagcaatacttacagtacagtttcttctcattttctct
caaaattgccctcatgctttcatatctttgcatgtgcttatattttgtgtggttgagatt
EXON 8  155 bp
cttgctcttcctggaattaaaagggtgactcagaattagagaattttcagggaagttaat
aaaattcaatacacagtctagaaaatataggtgtacaatggagatttcaaggacagatgt
ttgtgggtcactgagcccacatctctacagttggtctcaaataacactcatttattctag
AGGAACTCCTGCATTCTCACATCGCCCACTGGTGGTCACCAGATGGAGAAAGACTTGCCT
TCCTGATGATAAATGACTCTTTGGTACCCACCATGGTTATCCCTCGGTTTACTGGAGCGT
TGTATCCCAAAGGAAAGCAGTATCCGTATCCTAAG
gtaagtaacatggaagtactattttgttccttctctctctctgcactagtgacttgacag
atggtattcttggttcttgaacaagttgtctttggaggaaaacagaagttttccttactt
gtcagactcatcactttcgatctcccagtagtctatacacagtgcttgggtagagagagg
EXON 9  98 bp
tcttcaaaaacaattgagggcaatcatgttgtcgaatttaaaatcatttctacttcagag
aaattaaactttttttcttttctaacacaaaacagtaaatgaatcaaaaatccttttctt
ttttacccaatatattctaatgcttaatgtacttgcaatacaactttcattttctcaaag
GCAGGTCAAGTGAACCCAACAATAAAATTATATGTTGTAAACCTGTATGGACCAACTCAC
ACTTTGGAGCTCATGCCACCTGACAGCTTTAAATCAAG
gtatgcaatttcaatttcacttttatggggaaatagatattttcactccaattatcattt
tgttgcaatttagagagagatgtgatcagctcaacaaatccacttgaaaataaagctgaa
gttgcctacattagtgaggaatgaagtcattctcggtctctggctgttcctaggaagcat
EXON 10  124 bp
tatgtaaatattgaaaagagcagatatctatttatctatctatctatacataaattaata
tgtagcaacatccttatagtggttcagttattcttatatataaaatggcaaatgtatatt
gttggtactatatcaatgctctggctctaaacatacattttaattttgtttccaaactag
AGAATACTATATCACTATGGTTAAATGGGTAAGCAATACCAAGACTGTGGTAAGATGGTT
AAACCGAGCTCAGAACATCTCCATCCTCACAGTCTGTGAGACCACTACAGGTGCTTGTAG
TAAA
gtgagtataatttatttttcttttatgcctaaaatgaagtagcttatgcagctttacaaa
ggggaaacaggaaatgctttgtacaaaaaaaattcagtgtttaacttttaaaactaatag
gaaaagaattattctattaagaatatatactttaatttataaagcttccaaactttgaag
EXON 11  39 bp
tagtccctattctctacttactcattcagattaaatcaataatgacaatgaaatctctca
tggtgtttcaccagttgaagagagggaaaaaaaactgataaccgtgttttaaaaaagtta
aatttatatatgctcattttggtctttagatgcttcatggagttaattgttttgtttcag
AAATATGAGATGACATCAGATACGTGGCTCTCTCAGCAG
gtacagtataggtggtctgtcacatcttggccattgtgaccatcctgttcacccattttt
tatgtgataactttctgtaaaaagtatgagtttaaggctttgctaggtttgacagagtga
tcctttttcattaaaaggatcacttatgacttgggctttctatggtatcatttgtgaaaa
EXON 12  108 bp
cagatttactttaaaaaagtttaaaaaatagcatacattcatttttttaaaataatgtgc
ccattttcctaactaattataaatcaatatttggtataacccatgcaggaattaacagta
gtaggcagcacagattgcatgtgcctttctgagattgttctgtgctcttctgtattttag
AATGAGGAGCCCGTGTTTTCTAGAGACGGCAGCAAATTCTTTATGACAGTGCCTGTTAAG
CAAGGGGGACGTGGAGAATTTCACCACGTAGCTATGTTCCTCATCCAG
gtaagtgctggcttttttccatgttttgatttcattgtcctcatgtccccgaaggcccag
ttcttgtggcattctaaacctctagttcatggtggtgaaacccagccatatatacaactc
acagacatcttaggaagaggacctccatccatagccatacattcaagccttaccttccca
EXON 13  92 bp
ctacctgccttgatctgtgtttataggaatgcatgttcattcttgagctgtggaacagaa
aactgagtgttaactgagaattagagaattcgaagtgtcacaagcagttggtacattcgt
gtttaccagagagatgctgtttaaatgaaaggaaaatcaatattttctatttctttgcag
AGTAAAAGTGAGCAAATTACCGTGCGGCATCTGACATCAGGAAACTGGGAAGTGATAAAG
ATCTTGGCATACGATGAAACTACTCAAAAAAT
gtgagtgttttcagttctctagtcaggctgcaagttagcgttgtcaaatgccatcttttc
taatagaattatgttttgcttaccatagtcctagtcaaaacaagccagccatggaaagaa
taacctttctttaaagacctcttccacacttcacacagagacatcttacacagagggatg
EXON 14  48 bp
tagcaaaacaactcctgtctgtattttgacagttttaaaaattcaagtgaagatttaatg
tgaaaattcaggtgaagattcaatgtgaattcaggattcaatgtgacaatgtgacaaaat
tcacagatcacaaaaaatagatctgtgtctaatgcttgtgttgttttctttcctggacag
TTACTTTCTGAGCACTGAATCTTCTCCCAGAGGAAGGCAGCTGTACAG
gtaagcagtgtgcaaggatctccttacacagattggcttctcaatggctatctatgtagc
ataaggaaggaaaggaaaaatttgaaatgtctttttcaacatggctaggaagagccaact
ttgctgacaaagcttcacactcttgcaccagtctctcccttgacaggactggagaaaatg
EXON 15  122 bp
ttttaacattactaatagaaggtgactttttatgtatatggtgattcatagtttacagtg
aacctctatgcaagcaccgatgtaactcccttgtttatattatatttaaatatgaacacc
acacattcaagtgcctagaatagtagcatttctataataacttcctttttctttctccag
TGCTTCTACTGAAGGATTATTGAATCGCCAATGCATTTCATGTAATTTCATGAAAGAACA
ATGTACATATTTTGATGCCAGTTTTAGTCCCATGAATCAACATTTCTTATTATTCTGTGA
AG
gtaagataatacatgaattctgatataatatattttattcattgtatttggtcaatatct
gttggtatcagcaactattactctagatgatttcataatcttaatttataaatttttgtt
aataggatatacattatatatagacttactgagatacaattttttacatattttgtatag
EXON 16  48 bp
ttacccttctgaataaaacgcttataaataggaatgaaagctagttatctggtttctgtt
ttgttatgttttaaccacgaagtgcttccatttggggggaaaaaactattatgtaaactt
tctaatgattattacttagacatctttaaaaatatttatacacatatttttaaattccag
GTCCAAGGGTCCCAGTGGTCAGCCTACATAGTACGGACAACCCAGCAA
gtgagtacacaagaagacaattaagaatagttatggttggcattagtcttagacatcgtg
ttatctattctgagtcatatcctctataaattcttcttcaaaaaatccccaccatgagga
aagctgcgtgtataccatcaacttgaccttatgtatgtaagagaaacagtaaagcaagag
EXON 17  99 bp
gttttactggcctaatgaagcttacttagaaaactgttgtagtaattcaaaagagaaatg
atgagttaatcagcacagtgcctgccaaatggtaacaagtggataattttttgttgtgtc
acactgattctgtttaatgcataggggttagctatttacactaccctttttggtttacag
AATATTTTATATTGGAAAGCAATTCTATGCTGAAGGAAGCTATCCTGAAGAAGAAGATAG
GAAAGCCAGAAATTAAAATCCTTCATATTGACGACTATG
gtaaaattttgtgcatgctatgttattcaagaacaactttctctgcgtcttatagtttta
cctgcaaatgactctccatctttaatattttgctctttctttaaaagaacttcctttaca
gttgtcccttcccaaagattttatggaccgaaaccagtatgctcttctgttaataatgta
EXON 18  70 bp
atgctgaaggaagctatcctgaagaagaagataggaaagccagaaattaaaatccttcat
attgacgactatggtaaaattttgtgcatgctatgttattcaagaacaactttctctgcg
tcttatagttttacctgcaaatgactctccatctttaatattttgctctttctttaaaag
AACTTCCTTTACAGTTGTCCCTTCCCAAAGATTTTATGGACCGAAACCAGTATGCTCTTC
TGTTAATAAT
gtaagtattttatttgtttttaaaataaaggaatctaaagattttatatttttgtgtctc
acatgacaacatttgattcaataaagaagagaagtcctatgtgtgtagttaatcaggaca
gctgtctgttgtctaaattcctctagaagtccatcactaaatcatgtataaagatgtgta
EXON 19  195 bp
aaaatacaattttacgaaggaaaattgtaattttaccttcaggtttattatcaagaatta
acagaaattttaatagccagcacagttctttcccattacttaacttgtgagtatgaaagg
taaaatttctaccagattttcagttgctcttgttttggtccaatatgttggtatttgcag
GGATGAAGAACCAGGAGGCCAGCTGGTTACAGATAAGTTCCATATTGACTGGGATTCCGT
ACTCATTGACATGGATAATGTCATTGTAGCAAGATTTGATGGCAGAGGAAGTGGATTCCA
GGGTCTGAAAATTTTGCAGGAGATTCATCGAAGATTAGGTTCAGTAGAAGTAAAGGACCA
AATAACAGCTGTGAA
gtaagtggatgcacatttttcttctctgttttctataatgacagagtcttggtatatgac
atataatattactaaccctgactcaaggcttctattttagtgattgagcaattttgtaag
ttaatcataaagcctatttcattttttttttgaagtacctgtcacccttagtgctataat
EXON 20  55 bp
aggccatcactttgagtagcaagattttggagtatatgaccctaatacatgaacagagct
acagttagtaaagcatttctagtcattagctattgttttgtatgtatgcatgccaactat
atatttatatttgcatttaactcacaaagatataactattgtttttcgttttcattgcag
ATTTTTGCTGAAACTGCCTTACATTGACTCCAAAAGATTAAGCATTTTTGGAAAG
gtaaatagtagaaatgctgaatctatctttttatgcgtatctatgttatgtaatatccta
ttacacattcacaggaggccagttggttacagataagttccatattgactgggattccat
acttattaacatggaaaacctcactgtagcaagatttgatggcagaggaagtggattcca
EXON 21  100 bp
aatgattttggcttttttcccccaagcctgagacattctgatatgatgtacagtaccaaa
cattgatcaaaagctaaaaatgtctccaggcatagttgttatatataaatttgtgtgtgt
gtatgtgtgtgtgtgtgtgtgagatatatatatatatatatatatatttttcccccccag
GGTTATGGTGGCTATATTGCATCAATGATCTTAAAATCAGATGAAAAGCTTTTTAAATGT
GGATCCGTGGTTGCACCTATCACAGACTTGAAATTGTATG
gtgagtactttctacagactgacctagtataatgtattgatttgtagaaaacgaaagccc
aatttagaatagctcaattgagctcatttatcatatgttattagagcctgttttcagctg
tttatctcctccttgattcagctgattttactaaagcatgacaattaaatgtaaaatgaa
EXON 22  59 bp
agctcaattgagctcatttatcatatgttattagagcctgttttcagctgtttatctcct
ccttgattcagctgattttactaaagcatgacaattaaatgtaaaatgaagaaattaatg
aaatatgccagtcaaatagtttttagtttcttctcgaatgtctgttttcttgggtcacag
CCTCAGCTTTCTCTGAAAGATACCTTGGGATGCCATCTAAGGAAGAAAGCACTTACCAG
gtaactaatttgaaaataacaaagaaagaggagtatttttgttctaaaaaattagttaaa
tggcttatttagatctatagatacagatatttgtattttcctttataggcagccagtgtg
ctacataatgttcatggcttgaaagaagaaaatatattaataattcatggaactgctgac
EXON 23  73 bp
tcttgggtcacagcctcagctttctctgaaagataccttgggatgccatctaaggaagaa
agcacttaccaggtaactaatttgaaaataacaaagaaagaggagtatttttgttctaaa
aaattagttaaatggcttatttagatctatagatacagatatttgtattttcctttatag
GCAGCCAGTGTGCTACATAATGTTCATGGCTTGAAAGAAGAAAATATATTAATAATTCAT
GGAACTGCTGACA
gtaagtattatacttgccgctgctgtttgatagggtatgaccttttacaaagggatacat
ctaaggacttgcttacaggaagccctgtaaaccttctgaagaagggagcagagagtcaca
caaagaatcagatacatgatagaaggtgggaaaaaagaattcagagataagaggagagga
EXON 24  74 bp
cacctcggcctcccaaagtgctgagattacaggcgtgagccaccgtgcccagccagatat
aagtcttttaaatgtgcaatgtatgtaaaataaaacactgaatctctttgaaaaataata
tgaaaaagttctcatacaagcagtgtgtttcttcagatatcataatttgatttcttgcag
CAAAAGTTCATTTCCAACACTCAGCAGAATTAATCAAGCACCTAATAAAAGCTGGAGTGA
ATTATACTATGCAG
gtaagctactttcttagaagaacgtgttttcctgctgtgttttttcacttgtgagatacg
caacacagcttctctattattccattctccctactattattttttaatatgttttttagt
taccaaagattgtgttctctgttcctgattacaccgagaatgtggatgaactcatgcttt
EXON 25  2151 bp
taattgacatgattacaattgttttaaaagtttagcatgaataacttagagtagaattag
gtttgattttggtcagatattattactcaaagtttccatgacgttagggctcagaaaatg
aatgcgagagacaatagcttcttggataatttgaaatcttctttctcctcaatatcttag
GTCTACCCAGATGAAGGTCATAACGTATCTGAGAAGAGCAAGTATCATCTCTACAGCACA
ATCCTCAAATTCTTCAGTGATTGTTTGAAGGAAGAAATATCTGTGCTACCACAGGAACCA
GAAGAAGATGAATAATGGACTGTATTTATACAGAACTGAAGGGAATATTGAGGCTCAATG
AAACCTGACAAAGAGACTGTAATATTGTAGTTGCTCCAGAATGTCAAGGGCAGCTTACGG
AGATGTCACTGGAGCAGCACGCTCAGAGACAGTGAACTAGCATTTGAATACACAAGTCCA
AGTCTACTGTGTTGCTAGGGGTGCAGAACCCGTTTCTTTGTATGAGAGAGGTCAAAGGGT
TGGTTTCCTGGGAGAAATTAGTTTTGCATTAAAGTAGGAGTAGTGCATGTTTTCTTCTGT
TATCCCCCTGTTTGTTCTGTAACTAGTTGCTCTCATTTTAATTTCACTGGCCACCATCAT
CTTTGCATATAATGCACAATCTATCATCTGTCCTACAGTCCCTGATCTTTCATGGCTGAG
CTGCAATCTAACACTTTACTGTACCTTTATAATAAGTGCAATTCTTTCATTGTCTATTAT
TATGCTTAAGAAAATATTCAGTTAATAAAAAACAGAGTATTTTATGTAATTTCTGTTTTT
AAAAAGACATTATTAAATGGGTCAAAGGACATATAGAAATGTGGATTTCAGCACCTTCCA
AAGTTCAGCCAGTTATCAGTAGATACAATATCTTTAAATGAACACACGAGTGTATGTCTC
ACAATATATATACACAAGTGTGCATATACAGTTAATGAAACTATCTTTAAATGTTATTCA
TGCTATAAAGAGTAAACGTTTGATGAATTAGAAGAGATGCTCTTTTCCAAGCTATAATGG
ATGCTTTGTTTAATGAGCCAAATATGATGAAACATTTTTTCCAATTCAAATTCTAGCTAT
TGCTTTCCTATAAATGTTTGGGTTGTGTTTGGTATTGTTTTTAGTGGTTAATAGTTTTCC
AGTTGCATTTAATTTTTTGAATATGATACCTTGTCACATGTAAATTAGATACTTAAATAT
TAAATTATAGTTTCTGATAAAGAAATTTTGTTAACAATGCAATGCCACTGAGTGCTATTT
TGCTCTTTTGGTGGAGAAGGCTTTTTTCAAAACTCTTGGTCCTTTTACTTCTTTCTCTCA
GTGCAGAATCAATTCTCATTTTCATCGTAAAAGCAAATAGCTGGATTATTTCATTTGCCA
GTTTCTATTTAGTATTCCATGCCTGCCCAATTCATCTGTTACTGTTTAATTTCAATTCTT
CTGGTGAGAATTAGAAATGAAATATTTTTTATTCATTGGCCAAAAAGTTCACAGACAGCA
GTGTTTGCTATTTACTTTGAATTGAAGGCACAAAATGCATCAATTCCTGTGCTGTGTTGA
CTTGCAGTAGTAAGTAACTGAGAGCATAAAATAAACCTGACTGTATGAAGTCAATTTAAG
TGATGAGAACATTTAACTTTGGTGACTAAAGTCAGAATATCTTCTCACTTCACTTAAGGG
ATCTTCCAGAAGATATCTAAAAGTCTGTAATAAGCTTAGAAGTTCAGATAAATCTAGGCA
GGATACTGCATTTTTGTGGTTTTAAAAAAGTCCTTAGGACAGACTGAATTATCATAACTT
ATGGCATCAGGAGGAAACTTTAAAATATCAAGGAATCACTCAGTCACCCTCCTGTTTTGT
TGAAGGATCAACCCCAAATTCTGGGTATTTGAGTACATGTGAATCATGGATTTGGTATTC
AACTTTTTCCCTGGATGCTTTGGAATCGTGTCTTCCATGCTCCACTGGGTTCAATTTAAA
ATAGGAGAGGCTTTCTCTTCTGAAAGATCCATTTTAGGTCTTTTTCAAGAATAGTGAACA
CATTTTTTAACAAAATAAGTTGTAATTTTAAAAGGAAAGTTTTGCCTATTTTATTAAGAT
GGAAATTTCTTTTTAGGCTAATTTGAAATCCAACTGAAGCTTTTTAACCAATATTTTAAA
TTTGAACCACTAGAGTTTTTTATGATGCAAATGATTATGTTGTCTGAAAGGTGTGGTTTT
ATTGAATGTCTATTTGAGTATCATTTAAAAAGTATTTGCCTTTTACTGTCA
tcatttctcttgttttattattattatcaatgtttatctatttttcaattaatttaatac
agtttctaatgtgaaagacatttttctggaacccgttttccccttaaacactaaagagac
ctcaagtgaaagcatattgcttagtaggaaggtagaaaatgttaatccctgcgattcttt