Gene DNMT3A Variant 4
DNA : 61.14 KbNT_022184
mRNA : 1774 bp NM_175630
CDS : 501 bp NP_783329
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  161 bp
caaggcagctcatctcagagaggctttggagcctgcgggacggccaggaggagcctggcg
ctccgaccttggccctgtagagcagagtggcctctactccgcggcggcacctggctgggg
gttgcggcgcggttgggccagcgctgctgtccccagccccagtgctgaggcaggcagagc
GCAGTGGGCTCTGGCGGAGGTCGGGAGAACTGCAGGGCGAAGGCCGCCGGGGGCTCCGCG
GGCTGCGGGGGGAGGCACTTGACACCGGCCCGGGGAGAGGAGGGGCCGCTGTCCCTGCGG
CCAGTGCTGGATGCGGGGACCCAGCGCAGAAGCAGCGCCAG
gtagcggggcgcccagcgtggggagggctgcggcgaggcccggagctcggctacgactcg
aggggctctgagtggccgggagcgcggccgaggcggggcgcccggggcccggcccccggt
ctgggcggtgcggggtccagacctccgccaagcggcgtgcggggaccccggcggggccgc
EXON 2  249 bp
ggggtaggaggtggccctgaagggagcctgcctcggtttctctgctctctggggtgctgg
tgaggccagaaggaggagcaacaccccaggcctcacaggccaggtgtggccctgggctga
gggcctgacccagggagggtggggtgctccgccccactgatcctcttctctcccccacag
GTGGAGCCATCGAAGCCCCCACCCACAGGCTGACAGAGGCACCGTTCACCAGAGGGCTCA
ACACCGGGATCTATGTTTAAGTTTTAACTCTCGCCTCCAAAGACCACGATAATTCCTTCC
CCAAAGCCCAGCAGCCCCCCAGCCCCGCGCAGCCCCAGCCTGCCTCCCGGCGCCCAGATG
CCCGCCATGCCCTCCAGCGGCCCCGGGGACACCAGCAGCTCTGCTGCGGAGCGGGAGGAG
GACCGAAAG
gtgagcagcgggctctgctggggaccctctggcctgggagagggagagccctgtccctat
gtgatgacagccggctcctcatactgagtgcatgaccgcatcactcagtgctcacgacag
ggtgtgggaccatcacatccctgtttgggtgatgaggaaacggaggcttgcagaggttca
EXON 3  105 bp
caagcctcatcaggcaggaggggagttggtgggggcatattacacagccctggaagtgtg
gctcgtgggacaggaggaggctggggctggaagggaagccagggccagccccagacaggc
ctggaatgctacactgctgggatccacctctggcctcacaggctgtgtctgtgcctgcag
GACGGAGAGGAGCAGGAGGAGCCGCGTGGCAAGGAGGAGCGCCAAGAGCCCAGCACCACG
GCACGGAAGGTGGGGCGGCCTGGGAGGAAGCGCAAGCACCCCCCG
gtgagtgtcacatcctacacaccctcctgtgcacacacacaacacacacgtgcctggcct
gtcgatggcagtgatgtatgtcctgcagggacctggagacatttaagaccaggtgatggg
gtatacccctccagctgcaggtaccccattcttcaaatcccaccctcacatttccctgtt
EXON 4  1259 bp
aatcctttgatgttgaaagcaaaattgtgaatgtatctgtttgcatgaaggtttatatga
acacagtttctggacagaaagtgcataacattctctagaatttcagagcggtcaatgatc
caaaacaggctaagcccactgatctaaccctcctcttgtgtatctttcttacatttgcag
GTGGAAAGCGGTGACACGCCAAAGGACCCTGCGGTGATCTCCAAGTCCCCATCCATGGCC
CAGGACTCAGGCGCCTCAGAGCTATTACCCAATGGGGACTTGGAGAAGCGGAGTGAGCCC
CAGCCAGAGGAGGGGAGCCCTGCTGGGGGGCAGAAGGGCGGGGCCCCAGCAGAGGGAGAG
GGTGCAGCTGAGACCCTGCCTGAAGCCTCAAGAGCAGTGGAAAATGGCTGCTGCACCCCC
AAGGAGGGCCGAGGAGCCCCTGCAGAAGCGGGTGAGTCCTCAGCACCAGGGGCAGCCTCT
TCTGGGCCCACCAGCATACCCTGAGAGTCAGGGACTTGGCTCTCCAGCAGGTCCCAGGAA
GGATGGTCTGGGTCGTGGCTAAAGGTCTGCTTGCCAAGGCTATGGCCTGGAGGCTACTGG
CTGGATGCAGCCTGCGCATATGTTTTATTTGGCCCATAGAGTGTTTTAAACATTTAAAAA
ATTAGTTGCCAGTATTTAAAAATCAAAAAATTTCACATAAAAATCTGGAGTTTTGGCTTC
TCATGAAAAAAAAAAAAGCTAGATCTGGCAACAGCGGGCTTTCATAACGCCAACGATTGC
TAGACTGGGATAATGGCGGTCCCTCCATCGCCTTCTGTGGCTGGTTGTGGGCCTTAGTTT
TCTGCAGCTCTACCTGGCCTGCTTACTCTCCCACGTGCCATGCAGTTCCTGGGGGTTGCT
GTATTTGTAGCCCCTGGCCTGGGCACTCAAGGGCAGCAGATACCCTGTTTGCCTCCCTGA
GTGCAGAGGTCCTGAGCCCACCCTAGTTGGGCTGACTCAACTGGAAATTTGGTTGTGACA
GTGGCGTGGGGAGAGGGCTGGGTGATTGTATTCTGTGTACTGCCCAGCCCAGGCCTCTTC
ATCTGGGGACTTTTTGGCCTAACCCTGGAAGCCTGGAAAGTTGCCCACTTTTCTCTTTCA
GGTTAAGCCAGCAATTTCAGGGCCAACCGAGCTGTAAACATGTTAGTAATGAGGACAACT
AGCATTTGTACAGGGCTTCACAGTTTACAAAGCGCTTTCTCATACATTATCACATTTGAT
CCTCCCAGGGCCCTGCCAGGTTGTTTTGCATATGTGCATTTTAATTTCAAAAAGTCTTCC
TTCCAAGCGTGTATGATGAAATGAGTAAATTGATTAATTGGCGTAACTTATTTTGCATGG
ATCCAACCTAATGTTCATGCAGGATAGAGAACATTTCCAGAATACAAATTTCCAAACTT
attaagaagcttttattcatttattattcgacaaatatgtatgatgctcccactatgtgc
agaacactacagagggaatctgtattagttgttttatttactcctctaacaatcttattc
aagagatatgattatcctcatttcaggagaaaaatattgaggcttaaaacaatgatgtga