Gene DNMT3A Variant 3
DNA : 19.33 KbNT_022184
mRNA : 3588 bp NM_153759
CDS : 2070 bp NP_715640
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  118 bp
cgcccctcggaccggagaagaggggctggcccagcgccagcgtcggagcgccggccccct
ccccgggccgctcgcagccaaccaggccctccagcggggcccacgtgacctggagtccta
gacaaagaaaatgttccctccctcccccccgccgcccccctcccctcccagtggccccct
CCGCCCCCAGCCCCATCGCCCCCTTCCCCTCCCCCAAGACGGGCAGCTACTTCCAGAGCT
TCAGGGCCGCGGCTCACACCTGAGCGCGACTGCAGAGGGGCTGCACCTGGCCTTATGG
gtaggttcctggacggagccccggggagaccgggggcggggaggcggcagggccggtggg
aggatctccgcagccctccgggtttgaaaagagtgaagtatgcctccccggcccgcagca
gccgcggcgtcccggcctggcccgagttctggagatgctgacttagtgctggcccgccgc
EXON 2  68 bp
tctaggcccatgggggagctcttttgaaaggcatgtagaaaatggggttttctcccctct
aaatctggtatggtggaaatgggtgcaaagccttgaagtcagagggccgtgtttcctaga
ttcagtaaaaggctaatggttctcagagctaagtatcaaggatttcattctcctttgtag
GGATCCTGGAGCGGGTTGTGAGAAGGAATGGGCGCGTGGATCGTAGCCTGAAAGACGAGT
GTGATACG
gtgaaaggatggaggctgtgcaatgggagaataactggggtttggcttattaatttgttg
gtgggatggcagagagcacgcctggtctatagtgcctgctcagtaaataactgaatgaat
acatgtatttatggatctgaagggtgcacatagaaggggtcgaatctggtaacaatacac
EXON 3  216 bp
agttcacctctctacttcaagtctttccatttttcacggcaaggcagctggttggctctc
tccagcccttgaccttctgtcactgttccgggttttgacaaacatggtccccttgagtgt
caggtggccttgctaattcctggagaggtcaaggtgactttttgttttttgtttccccag
GCTGAGAAGAAAGCCAAGGTCATTGCAGGAATGAATGCTGTGGAAGAAAACCAGGGGCCC
GGGGAGTCTCAGAAGGTGGAGGAGGCCAGCCCTCCTGCTGTGCAGCAGCCCACTGACCCC
GCATCCCCCACTGTGGCTACCACGCCTGAGCCCGTGGGGTCCGATGCTGGGGACAAGAAT
GCCACCAAAGCAGGCGATGACGAGCCAGAGTACGAG
gtgagcggcttcttcaccagccgtggccagctctttccgggggccttccactgccagctc
ctcccgtcctgctctcctctctccatctcccacgggccgctcgctctctccacctgaccc
cgggcctcttcgtctccccgattttgctctgtcttgcctcattcagatggagctccctcc
EXON 4  159 bp
ctccacctgaccccgggcctcttcgtctccccgattttgctctgtcttgcctcattcaga
tggagctccctcctggctgtcctgccccccagatgcccagggctggggttgccatggggg
gatcagggtggcagggcctcgtgaccactgtgtaatgatttctgctccttggggctccag
GACGGCCGGGGCTTTGGCATTGGGGAGCTGGTGTGGGGGAAACTGCGGGGCTTCTCCTGG
TGGCCAGGCCGCATTGTGTCTTGGTGGATGACGGGCCGGAGCCGAGCAGCTGAAGGCACC
CGCTGGGTCATGTGGTTCGGAGACGGCAAATTCTCAGTG
gtaagttgtggggtttggcagtagcctggggtgggggaaggttcttgatcccagggcctg
tggttttggctgggggcagtctggaattggggtgatggaagtgggttctgctcaccccta
ctctgcctgtggtgggtggaagaagctgtagggataattaggttgcacctgtggctcaga
EXON 5  108 bp
gtacttccctactcttggtctggactcctctttgcatcgggtaattatttatcactgtat
ctggtcccctccagggctgagactgactctcgaggctcccagcccctgccagttgcaagg
catggggtgggtgcttgcaagtgtaagcctcggcaaacaaggcctggcttgtccccccag
GTGTGTGTTGAGAAGCTGATGCCGCTGAGCTCGTTTTGCAGTGCGTTCCACCAGGCCACG
TACAACAAGCAGCCCATGTACCGCAAAGCCATCTACGAGGTCCTGCAG
gtgagtgtccctgctgggagctcggaggaggagcctagagcactaggaggcctggaagtt
ggagtgcaggtcgggcttgagcagaacggaggcccaggaggcagcgactcctttctctcc
acctcgctcgcccgtatgcacatcccgctcctcctcagcggttcctccccatcttgcctg
EXON 6  157 bp
caggaggcagcgactcctttctctccacctcgctcgcccgtatgcacatcccgctcctcc
tcagcggttcctccccatcttgcctgtgccaccctcactactcagagtctggccttgagc
ctgacccatctgccttccagcctgtcctgacaaccccaaccctggcgtgtcaccctccag
GTGGCCAGCAGCCGCGCGGGGAAGCTGTTCCCGGTGTGCCACGACAGCGATGAGAGTGAC
ACTGCCAAGGCCGTGGAGGTGCAGAACAAGCCCATGATTGAATGGGCCCTGGGGGGCTTC
CAGCCTTCTGGCCCTAAGGGCCTGGAGCCACCAGAAG
gtaaatgagggcacccagctttctgggacccctgcccgccaggcagatccacaccagggc
tgggaaagccatgcttagggagggctgccaaggcctccacagaggggcccagtgggaaca
gccggggtctctcttgccctggggtcaggacttgaatgacctgctctctgttggttggct
EXON 7  150 bp
ctcttgccctggggtcaggacttgaatgacctgctctctgttggttggctagaaccgtag
agttgggaggtgggaacaagttggagaccaggccgcaccccactgtaaggagggtggggg
aaggggctggagtttcctgtcagcctgtaactgaccttggcacctgctttcctcctccag
AAGAGAAGAATCCCTACAAAGAAGTGTACACGGACATGTGGGTGGAACCTGAGGCAGCTG
CCTACGCACCACCTCCACCAGCCAAAAAGCCCCGGAAGAGCACAGCGGAGAAGCCCAAGG
TCAAGGAGATTATTGATGAGCGCACAAGAG
gtagttggcctgcttctggagagggtggcaccaggaggcctgcatccgaggagcaggcgc
ggcctcctctgacgccagctctcctccccttgcagagcggctggtgtacgaggtgcggca
gaagtgccggaacattgagggtaagtttgttgcctgggaactctggcactcctagtgtgg
EXON 8  45 bp
gcaccacctccaccagccaaaaagccccggaagagcacagcggagaagcccaaggtcaag
gagattattgatgagcgcacaagaggtagttggcctgcttctggagagggtggcaccagg
aggcctgcatccgaggagcaggcgcggcctcctctgacgccagctctcctccccttgcag
AGCGGCTGGTGTACGAGGTGCGGCAGAAGTGCCGGAACATTGAGG
gtaagtttgttgcctgggaactctggcactcctagtgtggcatggggcagagtagcagag
gcacttaggaaggtttgaatgacatgggaccaggggccacgtcctgcgtgtcacaccacc
ttcaccgtgcttcgtgcactgtctgtctttctggtgccatgattctgctctcctgtcaat
EXON 9  80 bp
gatgatggcgttcgagactggggtcacagtgcctcccttttccgtggggcaccctggact
cttttctggctgccgctctggcacaccccttttttgtggctggtctggtgctgggctccg
gcccggggagggagaggcccttcggtggtactcaccccatcccctccctctgctttccag
ACATCTGCATCTCCTGTGGGAGCCTCAATGTTACCCTGGAACACCCCCTCTTCGTTGGAG
GAATGTGCCAAAACTGCAAG
gtaggagcacacccacccaggagaggtgccgttgaggccggcccttcggccttctggctg
actgtgtccaccgcttctgggcatgtacagggtgacacccggtgtgcgtgtgatgtagac
ttcagagcttcctctggaagcagagtcctgatgacacgggcccttgggtttcaagctttt
EXON 10  113 bp
cacaggcagatgaggtttccccttcccagatctgcagctggggcctgaccctggctaagg
tggtggcggggtcatgtcttcagggcttaggctctgtgaggccaggtgtggagcctccct
tcgtcctggccgtcctgggacccgtcctggtggtttctgacccttcccgctgctgtctag
AACTGCTTTCTGGAGTGTGCGTACCAGTACGACGACGACGGCTACCAGTCCTACTGCACC
ATCTGCTGTGGGGGCCGTGAGGTGCTCATGTGCGGAAACAACAACTGCTGCAG
gtgaggctgttgtggcctccagtggtctccttagctgggccccaggctcccgccgcccac
cgcctcccctcctctcccttccccacagaccctccaccccctagccatgctccagacccg
gtctttccattccaggtagcacaccttggcctccccggaccagggctgagagtctcctct
EXON 11  184 bp
gtggtctccttagctgggccccaggctcccgccgcccaccgcctcccctcctctcccttc
cccacagaccctccaccccctagccatgctccagacccggtctttccattccaggtagca
caccttggcctccccggaccagggctgagagtctcctctgctcactgggtctccttccag
GTGCTTTTGCGTGGAGTGTGTGGACCTCTTGGTGGGGCCGGGGGCTGCCCAGGCAGCCAT
TAAGGAAGACCCCTGGAACTGCTACATGTGCGGGCACAAGGGTACCTACGGGCTGCTGCG
GCGGCGAGAGGACTGGCCCTCCCGGCTCCAGATGTTCTTCGCTAATAACCACGACCAGGA
ATTT
gtgagtgctgggcctggggcgcggtctcgagctcccttggctgagccttggttgtggggc
ctgagctgtgcgcagggtgtgtgggtctaggagcctggctggagggccagcgctgggtgg
gagcttgggacaccgctgggcctgcatctgacctgttgtgctcactgcttaggaccctcc
EXON 12  85 bp
aggaatttgtgagtgctgggcctggggcgcggtctcgagctcccttggctgagccttggt
tgtggggcctgagctgtgcgcagggtgtgtgggtctaggagcctggctggagggccagcg
ctgggtgggagcttgggacaccgctgggcctgcatctgacctgttgtgctcactgcttag
GACCCTCCAAAGGTTTACCCACCTGTCCCAGCTGAGAAGAGGAAGCCCATCCGGGTGCTG
TCTCTCTTTGATGGAATCGCTACAG
gtgaggggtgcaggcccaagaggtgctggccgccttgtcccaggatgggggagccaggtg
tgtgggcaactctggcaaaacgaaatgatggttagcttcacagctgttaaaatattatcc
caaaggggaagcttgtgtgtgaagtggaaacgtatgcagtccgtggacttagatttgacc
EXON 13  146 bp
tgtccttactatggatactccagttggatccagaaaggatttaaggcatcttcagggaaa
agataggacttgggcctacagctgaccccatgggtcctgttggccagcaggctcacctgc
cgagaccagggtgccagggagatggctccaagtaacggtgctgtctgctggctggtgcag
GGCTCCTGGTGCTGAAGGACTTGGGCATTCAGGTGGACCGCTACATTGCCTCGGAGGTGT
GTGAGGACTCCATCACGGTGGGCATGGTGCGGCACCAGGGGAAGATCATGTACGTCGGGG
ACGTCCGCAGCGTCACACAGAAGCAT
gtatgtccatgctgtggggcgcagcccgtcttcccctccctgcacactcagcacctggag
gcagcccttgcctcctttcattttgttcatttgccctctttctcttcaccctttgcccca
gcctctttttctccttatcttccatttgtcctctgtcttgagagggtaaagggcaaattg
EXON 14  91 bp
cccgttcttgtttaggacttgtccatggttgcagctagggtcgtgagcctgcagagcagc
tgggtctcctctctttcgtgtcaaaggacttctttgccaagttcacagataatttctctt
tcttcctgtctgcctctgtccctggacagcaggcccatcacgttgcctttatcctcccag
ATCCAGGAGTGGGGCCCATTCGATCTGGTGATTGGGGGCAGTCCCTGCAATGACCTCTCC
ATCGTCAACCCTGCTCGCAAGGGCCTCTACG
gtaggtaccatcctgtcccctccaccttctcagctggtgcttccgcacataggcttcctc
cttggatatttctgccctgggacagctattcccgatgaccctgtcttcccgtgccctccc
cgtgcccgagccacaccactgtcctatgcagacagccccagctgatggctttctcttccg
EXON 15  149 bp
atcctgtcccctccaccttctcagctggtgcttccgcacataggcttcctccttggatat
ttctgccctgggacagctattcccgatgaccctgtcttcccgtgccctccccgtgcccga
gccacaccactgtcctatgcagacagccccagctgatggctttctcttccgacctctcag
AGGGCACTGGCCGGCTCTTCTTTGAGTTCTACCGCCTCCTGCATGATGCGCGGCCCAAGG
AGGGAGATGATCGCCCCTTCTTCTGGCTCTTTGAGAATGTGGTGGCCATGGGCGTTAGTG
ACAAGAGGGACATCTCGCGATTTCTCGAG
gtatagccagcaaccttggtttggccagctcactaatggcttctaccttggactgctgct
tcatcctgtctcatctgcattgtggagctggggactggtgacttctgctttgcaaggggc
ctgtttgggaagccccaggcttcctggatagaaagggaggaagcagggttagaggcctac
EXON 16  86 bp
gcttgtggaatgtggctaggtgtaattccagcttctcctggaggctgcaggctagcccag
tgtgtggctcctgagagagaagtaagaggctttgaggctttaaggctcgaccccagcagc
atgccggcgctgtttcatgctcctccttggctcatcttcaaaccgtctcctgttttgtag
TCCAACCCTGTGATGATTGATGCCAAAGAAGTGTCAGCTGCACACAGGGCCCGCTACTTC
TGGGGTAACCTTCCCGGTATGAACAG
gttggtgaaagctcctgggcctggggggctgtgggctgggactgcaggtgggatgaccca
tagtggggaagcccctgagccgggccctctctggccggcctctgctgaatgactagctgc
tctgccatgttccttatttccttttccttgaggaggaagaggagtcagggtatagaaaat
EXON 17  70 bp
tgtgtgttcgtgtgtttgcggggagtttgaagagagttatgacgtgtgtgcgtgatttgg
ggaaggggctcttaccctgtgaactagtggctgctgggggagggaggggagtcgtgcagc
tggggcccttcccgctgttatccaggtttctgttgttacagtctctcttctgcctcctag
GCCGTTGGCATCCACTGTGAATGATAAGCTGGAGCTGCAGGAGTGTCTGGAGCATGGCAG
GATAGCCAAG
gtcagctccagcgtctagaacctctgctggggggcagggagaaggaagggcaggatgagg
tggagcggtggccagggccttgtcccgcctgcttctccagctagtgtggagaatgcaatt
taggagacggtgcagggtcatgcagcagggcagccagaggagggcccagggctgctggcc
EXON 18  119 bp
tgtggggtctgtggaggctcctgccctgcgaactctgctcactcagagccatacccagcc
ccctgggtggaccaggccctgtcagggtttggcgagtacctggcatatttggtagacgca
tgaccagtgttggctggtgaatgaattcgtgcttattcctcttttctcctcttcatctag
TTCAGCAAAGTGAGGACCATTACTACGAGGTCAAACTCCATAAAGCAGGGCAAAGACCAG
CATTTTCCTGTCTTCATGAATGAGAAAGAGGACATCTTATGGTGCACTGAAATGGAAAG
gtacccgggttgtgctggcatctggctgcggtgtggctgttctgattgctgtgcttgctg
cgggggtcctctgcctttcccacctgacttgttttccacaaacgtcctgggaacagtggg
ttttatcaagcatttcccaacatggcagactcctggggtggactcctgacaccccaggct
EXON 19  1444 bp
aaaggacagaagattcggcagaactaagcaggcgtcagaggagttggtgggtgtgagtgc
ccctgtccctgcacttcgggtggctgctggtcctccgggtcctgctgtgtggttagacgg
cttccgggcagcctggtctggccagcactcaccctgccctctctgccttttctcccccag
GGTATTTGGTTTCCCAGTCCACTATACTGACGTCTCCAACATGAGCCGCTTGGCGAGGCA
GAGACTGCTGGGCCGGTCATGGAGCGTGCCAGTCATCCGCCACCTCTTCGCTCCGCTGAA
GGAGTATTTTGCGTGTGTGTAAGGGACATGGGGGCAAACTGAGGTAGCGACACAAAGTTA
AACAAACAAACAAAAAACACAAAACATAATAAAACACCAAGAACATGAGGATGGAGAGAA
GTATCAGCACCCAGAAGAGAAAAAGGAATTTAAAACAAAAACCACAGAGGCGGAAATACC
GGAGGGCTTTGCCTTGCGAAAAGGGTTGGACATCATCTCCTGATTTTTCAATGTTATTCT
TCAGTCCTATTTAAAAACAAAACCAAGCTCCCTTCCCTTCCTCCCCCTTCCCTTTTTTTT
CGGTCAGACCTTTTATTTTCTACTCTTTTCAGAGGGGTTTTCTGTTTGTTTGGGTTTTGT
TTCTTGCTGTGACTGAAACAAGAAGGTTATTGCAGCAAAAATCAGTAACAAAAAATAGTA
ACAATACCTTGCAGAGGAAAGGTGGGAGAGAGGAAAAAAGGAAATTCTATAGAAATCTAT
ATATTGGGTTGTTTTTTTTTTTGTTTTTTGTTTTTTTTTTTTGGGTTTTTTTTTTTACTA
TATATCTTTTTTTTGTTGTCTCTAGCCTGATCAGATAGGAGCACAAGCAGGGGACGGAAA
GAGAGAGACACTCAGGCGGCAGCATTCCCTCCCAGCCACTGAGCTGTCGTGCCAGCACCA
TTCCTGGTCACGCAAAACAGAACCCAGTTAGCAGCAGGGAGACGAGAACACCACACAAGA
CATTTTTCTACAGTATTTCAGGTGCCTACCACACAGGAAACCTTGAAGAAAATCAGTTTC
TAGAAGCCGCTGTTACCTCTTGTTTACAGTTTATATATATATGATAGATATGAGATATAT
ATATAAAAGGTACTGTTAACTACTGTACAACCCGACTTCATAATGGTGCTTTCAAACAGC
GAGATGAGTAAAAACATCAGCTTCCACGTTGCCTTCTGCGCAAAGGGTTTCACCAAGGAT
GGAGAAAGGGAGACAGCTTGCAGATGGCGCGTTCTCACGGTGGGCTCTTCCCCTTGGTTT
GTAACGAAGTGAAGGAGGAGAACTTGGGAGCCAGGTTCTCCCTGCCAAAAAGGGGGCTAG
ATGAGGTGGTCGGGCCCGTGGACAGCTGAGAGTGGGATTCATCCAGACTCATGCAATAAC
CCTTTGATTGTTTTCTAAAAGGAGACTCCCTCGGCAAGATGGCAGAGGGTACGGAGTCTT
CAGGCCCAGTTTCTCACTTTAGCCAATTCGAGGGCTCCTTGTGGTGGGATCAGAACTAAT
CCAGAGTGTGGGAAAGTGACAGTCAAAACCCCACCTGGAGCAAATAAAAAAACATACAAA
ACGT
actggtgctttcctgtctaagtcgccttttgtgtgttcttttatgaggcccccaccatcc
acccctctgtgcacaaggcggctcccggcccctggaatgtgatgtttttggtcatctcca
aaggctgcagttttatactgggaggctgatgacaccttttattataattattcttatggt