Gene DNMT3A Variant 2
DNA : 108.93 KbNT_022184
mRNA : 4298 bp NM_022552
CDS : 2739 bp NP_072046
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  80 bp
ctgggcccgcgggcggccggagggagggaaggaggaaggcggagagaaggggtgggaggg
ggggacccggcggaggaggcggagagagggagcgcgacagcgagcggagggagggagcga
gcgagcgaggcaggcaggcgggccgggagggagggagggcgcgcgggcggcggcggcggc
GAGAGCAGAGGACGAGCCGGGACGCGGCGCCGCGGCACCAGGGCGCGCAGCCGGGCCGGC
CCGACCCCACCGGCCATACG
gtaatgagcgccgctgctggcggcccggaaggccggcccggaggcggcggggagccgggg
agccgggcggggggcgccgcggctggcagtgcccggctcggggcacgctcccggacccct
gcaactcggcgccgggcgcccgtggggccgggactgcaggcggggacggcgggccgggct
EXON 2  249 bp
ggggtaggaggtggccctgaagggagcctgcctcggtttctctgctctctggggtgctgg
tgaggccagaaggaggagcaacaccccaggcctcacaggccaggtgtggccctgggctga
gggcctgacccagggagggtggggtgctccgccccactgatcctcttctctcccccacag
GTGGAGCCATCGAAGCCCCCACCCACAGGCTGACAGAGGCACCGTTCACCAGAGGGCTCA
ACACCGGGATCTATGTTTAAGTTTTAACTCTCGCCTCCAAAGACCACGATAATTCCTTCC
CCAAAGCCCAGCAGCCCCCCAGCCCCGCGCAGCCCCAGCCTGCCTCCCGGCGCCCAGATG
CCCGCCATGCCCTCCAGCGGCCCCGGGGACACCAGCAGCTCTGCTGCGGAGCGGGAGGAG
GACCGAAAG
gtgagcagcgggctctgctggggaccctctggcctgggagagggagagccctgtccctat
gtgatgacagccggctcctcatactgagtgcatgaccgcatcactcagtgctcacgacag
ggtgtgggaccatcacatccctgtttgggtgatgaggaaacggaggcttgcagaggttca
EXON 3  105 bp
caagcctcatcaggcaggaggggagttggtgggggcatattacacagccctggaagtgtg
gctcgtgggacaggaggaggctggggctggaagggaagccagggccagccccagacaggc
ctggaatgctacactgctgggatccacctctggcctcacaggctgtgtctgtgcctgcag
GACGGAGAGGAGCAGGAGGAGCCGCGTGGCAAGGAGGAGCGCCAAGAGCCCAGCACCACG
GCACGGAAGGTGGGGCGGCCTGGGAGGAAGCGCAAGCACCCCCCG
gtgagtgtcacatcctacacaccctcctgtgcacacacacaacacacacgtgcctggcct
gtcgatggcagtgatgtatgtcctgcagggacctggagacatttaagaccaggtgatggg
gtatacccctccagctgcaggtaccccattcttcaaatcccaccctcacatttccctgtt
EXON 4  271 bp
aatcctttgatgttgaaagcaaaattgtgaatgtatctgtttgcatgaaggtttatatga
acacagtttctggacagaaagtgcataacattctctagaatttcagagcggtcaatgatc
caaaacaggctaagcccactgatctaaccctcctcttgtgtatctttcttacatttgcag
GTGGAAAGCGGTGACACGCCAAAGGACCCTGCGGTGATCTCCAAGTCCCCATCCATGGCC
CAGGACTCAGGCGCCTCAGAGCTATTACCCAATGGGGACTTGGAGAAGCGGAGTGAGCCC
CAGCCAGAGGAGGGGAGCCCTGCTGGGGGGCAGAAGGGCGGGGCCCCAGCAGAGGGAGAG
GGTGCAGCTGAGACCCTGCCTGAAGCCTCAAGAGCAGTGGAAAATGGCTGCTGCACCCCC
AAGGAGGGCCGAGGAGCCCCTGCAGAAGCGG
gtgagtcctcagcaccaggggcagcctcttctgggcccaccagcataccctgagagtcag
ggacttggctctccagcaggtcccaggaaggatggtctgggtcgtggctaaaggtctgct
tgccaaggctatggcctggaggctactggctggatgcagcctgcgcatatgttttatttg
EXON 5  44 bp
tcagggtcagcactgtgcctggcatgtggtgggccatcatatttaacacatgaacagcta
aacggccagaggacccccatcccctgtggcagggaccccaggcacaaggtggggcctgtg
agccactccagtaattctgccgaccaacgaactggtccctttgttcttccctctccacag
GCAAAGAACAGAAGGAGACCAACATCGAATCCATGAAAATGGAG
gcaagtgttccacccccaggggctctgtggatcctgattctagaagaaggacacgggtgg
cgagtgtgtgtgagggggcggagggtgggcccctcctccttctttacacatccctctgtg
ggaaggagaggaagtgggcgtggaggttggaagtcccccaacaaggcagccggctcatcc
EXON 6  147 bp
ccccccacccccgccacacatgcccctcgctcctccagcccacacggggcctgcccagca
ctcccaggggtgccctctctggccaggagccagtgtccacattgtgtttgaggcgagtgc
ctccttggtgggtccgtcagtgcccaccctaatgccctaatgtctgtctctctgtcctag
GGCTCCCGGGGCCGGCTGCGGGGTGGCTTGGGCTGGGAGTCCAGCCTCCGTCAGCGGCCC
ATGCCGAGGCTCACCTTCCAGGCGGGGGACCCCTACTACATCAGCAAGCGCAAGCGGGAC
GAGTGGCTGGCACGCTGGAAAAGGGAG
gtgaggcgccttctggcctgggccccagcccgtcctgcagaactggaaaaccagaagtga
tgggcctcagtttccccttcaggctaacccttagaacttactgggagcctcttaatctct
agtcatgatgactggttcatctgctccttcagcagatgcttattgaacacttactgtata
EXON 7  216 bp
agttcacctctctacttcaagtctttccatttttcacggcaaggcagctggttggctctc
tccagcccttgaccttctgtcactgttccgggttttgacaaacatggtccccttgagtgt
caggtggccttgctaattcctggagaggtcaaggtgactttttgttttttgtttccccag
GCTGAGAAGAAAGCCAAGGTCATTGCAGGAATGAATGCTGTGGAAGAAAACCAGGGGCCC
GGGGAGTCTCAGAAGGTGGAGGAGGCCAGCCCTCCTGCTGTGCAGCAGCCCACTGACCCC
GCATCCCCCACTGTGGCTACCACGCCTGAGCCCGTGGGGTCCGATGCTGGGGACAAGAAT
GCCACCAAAGCAGGCGATGACGAGCCAGAGTACGAG
gtgagcggcttcttcaccagccgtggccagctctttccgggggccttccactgccagctc
ctcccgtcctgctctcctctctccatctcccacgggccgctcgctctctccacctgaccc
cgggcctcttcgtctccccgattttgctctgtcttgcctcattcagatggagctccctcc
EXON 8  159 bp
ctccacctgaccccgggcctcttcgtctccccgattttgctctgtcttgcctcattcaga
tggagctccctcctggctgtcctgccccccagatgcccagggctggggttgccatggggg
gatcagggtggcagggcctcgtgaccactgtgtaatgatttctgctccttggggctccag
GACGGCCGGGGCTTTGGCATTGGGGAGCTGGTGTGGGGGAAACTGCGGGGCTTCTCCTGG
TGGCCAGGCCGCATTGTGTCTTGGTGGATGACGGGCCGGAGCCGAGCAGCTGAAGGCACC
CGCTGGGTCATGTGGTTCGGAGACGGCAAATTCTCAGTG
gtaagttgtggggtttggcagtagcctggggtgggggaaggttcttgatcccagggcctg
tggttttggctgggggcagtctggaattggggtgatggaagtgggttctgctcaccccta
ctctgcctgtggtgggtggaagaagctgtagggataattaggttgcacctgtggctcaga
EXON 9  108 bp
gtacttccctactcttggtctggactcctctttgcatcgggtaattatttatcactgtat
ctggtcccctccagggctgagactgactctcgaggctcccagcccctgccagttgcaagg
catggggtgggtgcttgcaagtgtaagcctcggcaaacaaggcctggcttgtccccccag
GTGTGTGTTGAGAAGCTGATGCCGCTGAGCTCGTTTTGCAGTGCGTTCCACCAGGCCACG
TACAACAAGCAGCCCATGTACCGCAAAGCCATCTACGAGGTCCTGCAG
gtgagtgtccctgctgggagctcggaggaggagcctagagcactaggaggcctggaagtt
ggagtgcaggtcgggcttgagcagaacggaggcccaggaggcagcgactcctttctctcc
acctcgctcgcccgtatgcacatcccgctcctcctcagcggttcctccccatcttgcctg
EXON 10  157 bp
caggaggcagcgactcctttctctccacctcgctcgcccgtatgcacatcccgctcctcc
tcagcggttcctccccatcttgcctgtgccaccctcactactcagagtctggccttgagc
ctgacccatctgccttccagcctgtcctgacaaccccaaccctggcgtgtcaccctccag
GTGGCCAGCAGCCGCGCGGGGAAGCTGTTCCCGGTGTGCCACGACAGCGATGAGAGTGAC
ACTGCCAAGGCCGTGGAGGTGCAGAACAAGCCCATGATTGAATGGGCCCTGGGGGGCTTC
CAGCCTTCTGGCCCTAAGGGCCTGGAGCCACCAGAAG
gtaaatgagggcacccagctttctgggacccctgcccgccaggcagatccacaccagggc
tgggaaagccatgcttagggagggctgccaaggcctccacagaggggcccagtgggaaca
gccggggtctctcttgccctggggtcaggacttgaatgacctgctctctgttggttggct
EXON 11  150 bp
ctcttgccctggggtcaggacttgaatgacctgctctctgttggttggctagaaccgtag
agttgggaggtgggaacaagttggagaccaggccgcaccccactgtaaggagggtggggg
aaggggctggagtttcctgtcagcctgtaactgaccttggcacctgctttcctcctccag
AAGAGAAGAATCCCTACAAAGAAGTGTACACGGACATGTGGGTGGAACCTGAGGCAGCTG
CCTACGCACCACCTCCACCAGCCAAAAAGCCCCGGAAGAGCACAGCGGAGAAGCCCAAGG
TCAAGGAGATTATTGATGAGCGCACAAGAG
gtagttggcctgcttctggagagggtggcaccaggaggcctgcatccgaggagcaggcgc
ggcctcctctgacgccagctctcctccccttgcagagcggctggtgtacgaggtgcggca
gaagtgccggaacattgagggtaagtttgttgcctgggaactctggcactcctagtgtgg
EXON 12  45 bp
gcaccacctccaccagccaaaaagccccggaagagcacagcggagaagcccaaggtcaag
gagattattgatgagcgcacaagaggtagttggcctgcttctggagagggtggcaccagg
aggcctgcatccgaggagcaggcgcggcctcctctgacgccagctctcctccccttgcag
AGCGGCTGGTGTACGAGGTGCGGCAGAAGTGCCGGAACATTGAGG
gtaagtttgttgcctgggaactctggcactcctagtgtggcatggggcagagtagcagag
gcacttaggaaggtttgaatgacatgggaccaggggccacgtcctgcgtgtcacaccacc
ttcaccgtgcttcgtgcactgtctgtctttctggtgccatgattctgctctcctgtcaat
EXON 13  80 bp
gatgatggcgttcgagactggggtcacagtgcctcccttttccgtggggcaccctggact
cttttctggctgccgctctggcacaccccttttttgtggctggtctggtgctgggctccg
gcccggggagggagaggcccttcggtggtactcaccccatcccctccctctgctttccag
ACATCTGCATCTCCTGTGGGAGCCTCAATGTTACCCTGGAACACCCCCTCTTCGTTGGAG
GAATGTGCCAAAACTGCAAG
gtaggagcacacccacccaggagaggtgccgttgaggccggcccttcggccttctggctg
actgtgtccaccgcttctgggcatgtacagggtgacacccggtgtgcgtgtgatgtagac
ttcagagcttcctctggaagcagagtcctgatgacacgggcccttgggtttcaagctttt
EXON 14  113 bp
cacaggcagatgaggtttccccttcccagatctgcagctggggcctgaccctggctaagg
tggtggcggggtcatgtcttcagggcttaggctctgtgaggccaggtgtggagcctccct
tcgtcctggccgtcctgggacccgtcctggtggtttctgacccttcccgctgctgtctag
AACTGCTTTCTGGAGTGTGCGTACCAGTACGACGACGACGGCTACCAGTCCTACTGCACC
ATCTGCTGTGGGGGCCGTGAGGTGCTCATGTGCGGAAACAACAACTGCTGCAG
gtgaggctgttgtggcctccagtggtctccttagctgggccccaggctcccgccgcccac
cgcctcccctcctctcccttccccacagaccctccaccccctagccatgctccagacccg
gtctttccattccaggtagcacaccttggcctccccggaccagggctgagagtctcctct
EXON 15  184 bp
gtggtctccttagctgggccccaggctcccgccgcccaccgcctcccctcctctcccttc
cccacagaccctccaccccctagccatgctccagacccggtctttccattccaggtagca
caccttggcctccccggaccagggctgagagtctcctctgctcactgggtctccttccag
GTGCTTTTGCGTGGAGTGTGTGGACCTCTTGGTGGGGCCGGGGGCTGCCCAGGCAGCCAT
TAAGGAAGACCCCTGGAACTGCTACATGTGCGGGCACAAGGGTACCTACGGGCTGCTGCG
GCGGCGAGAGGACTGGCCCTCCCGGCTCCAGATGTTCTTCGCTAATAACCACGACCAGGA
ATTT
gtgagtgctgggcctggggcgcggtctcgagctcccttggctgagccttggttgtggggc
ctgagctgtgcgcagggtgtgtgggtctaggagcctggctggagggccagcgctgggtgg
gagcttgggacaccgctgggcctgcatctgacctgttgtgctcactgcttaggaccctcc
EXON 16  85 bp
aggaatttgtgagtgctgggcctggggcgcggtctcgagctcccttggctgagccttggt
tgtggggcctgagctgtgcgcagggtgtgtgggtctaggagcctggctggagggccagcg
ctgggtgggagcttgggacaccgctgggcctgcatctgacctgttgtgctcactgcttag
GACCCTCCAAAGGTTTACCCACCTGTCCCAGCTGAGAAGAGGAAGCCCATCCGGGTGCTG
TCTCTCTTTGATGGAATCGCTACAG
gtgaggggtgcaggcccaagaggtgctggccgccttgtcccaggatgggggagccaggtg
tgtgggcaactctggcaaaacgaaatgatggttagcttcacagctgttaaaatattatcc
caaaggggaagcttgtgtgtgaagtggaaacgtatgcagtccgtggacttagatttgacc
EXON 17  146 bp
tgtccttactatggatactccagttggatccagaaaggatttaaggcatcttcagggaaa
agataggacttgggcctacagctgaccccatgggtcctgttggccagcaggctcacctgc
cgagaccagggtgccagggagatggctccaagtaacggtgctgtctgctggctggtgcag
GGCTCCTGGTGCTGAAGGACTTGGGCATTCAGGTGGACCGCTACATTGCCTCGGAGGTGT
GTGAGGACTCCATCACGGTGGGCATGGTGCGGCACCAGGGGAAGATCATGTACGTCGGGG
ACGTCCGCAGCGTCACACAGAAGCAT
gtatgtccatgctgtggggcgcagcccgtcttcccctccctgcacactcagcacctggag
gcagcccttgcctcctttcattttgttcatttgccctctttctcttcaccctttgcccca
gcctctttttctccttatcttccatttgtcctctgtcttgagagggtaaagggcaaattg
EXON 18  91 bp
cccgttcttgtttaggacttgtccatggttgcagctagggtcgtgagcctgcagagcagc
tgggtctcctctctttcgtgtcaaaggacttctttgccaagttcacagataatttctctt
tcttcctgtctgcctctgtccctggacagcaggcccatcacgttgcctttatcctcccag
ATCCAGGAGTGGGGCCCATTCGATCTGGTGATTGGGGGCAGTCCCTGCAATGACCTCTCC
ATCGTCAACCCTGCTCGCAAGGGCCTCTACG
gtaggtaccatcctgtcccctccaccttctcagctggtgcttccgcacataggcttcctc
cttggatatttctgccctgggacagctattcccgatgaccctgtcttcccgtgccctccc
cgtgcccgagccacaccactgtcctatgcagacagccccagctgatggctttctcttccg
EXON 19  149 bp
atcctgtcccctccaccttctcagctggtgcttccgcacataggcttcctccttggatat
ttctgccctgggacagctattcccgatgaccctgtcttcccgtgccctccccgtgcccga
gccacaccactgtcctatgcagacagccccagctgatggctttctcttccgacctctcag
AGGGCACTGGCCGGCTCTTCTTTGAGTTCTACCGCCTCCTGCATGATGCGCGGCCCAAGG
AGGGAGATGATCGCCCCTTCTTCTGGCTCTTTGAGAATGTGGTGGCCATGGGCGTTAGTG
ACAAGAGGGACATCTCGCGATTTCTCGAG
gtatagccagcaaccttggtttggccagctcactaatggcttctaccttggactgctgct
tcatcctgtctcatctgcattgtggagctggggactggtgacttctgctttgcaaggggc
ctgtttgggaagccccaggcttcctggatagaaagggaggaagcagggttagaggcctac
EXON 20  86 bp
gcttgtggaatgtggctaggtgtaattccagcttctcctggaggctgcaggctagcccag
tgtgtggctcctgagagagaagtaagaggctttgaggctttaaggctcgaccccagcagc
atgccggcgctgtttcatgctcctccttggctcatcttcaaaccgtctcctgttttgtag
TCCAACCCTGTGATGATTGATGCCAAAGAAGTGTCAGCTGCACACAGGGCCCGCTACTTC
TGGGGTAACCTTCCCGGTATGAACAG
gttggtgaaagctcctgggcctggggggctgtgggctgggactgcaggtgggatgaccca
tagtggggaagcccctgagccgggccctctctggccggcctctgctgaatgactagctgc
tctgccatgttccttatttccttttccttgaggaggaagaggagtcagggtatagaaaat
EXON 21  70 bp
tgtgtgttcgtgtgtttgcggggagtttgaagagagttatgacgtgtgtgcgtgatttgg
ggaaggggctcttaccctgtgaactagtggctgctgggggagggaggggagtcgtgcagc
tggggcccttcccgctgttatccaggtttctgttgttacagtctctcttctgcctcctag
GCCGTTGGCATCCACTGTGAATGATAAGCTGGAGCTGCAGGAGTGTCTGGAGCATGGCAG
GATAGCCAAG
gtcagctccagcgtctagaacctctgctggggggcagggagaaggaagggcaggatgagg
tggagcggtggccagggccttgtcccgcctgcttctccagctagtgtggagaatgcaatt
taggagacggtgcagggtcatgcagcagggcagccagaggagggcccagggctgctggcc
EXON 22  119 bp
tgtggggtctgtggaggctcctgccctgcgaactctgctcactcagagccatacccagcc
ccctgggtggaccaggccctgtcagggtttggcgagtacctggcatatttggtagacgca
tgaccagtgttggctggtgaatgaattcgtgcttattcctcttttctcctcttcatctag
TTCAGCAAAGTGAGGACCATTACTACGAGGTCAAACTCCATAAAGCAGGGCAAAGACCAG
CATTTTCCTGTCTTCATGAATGAGAAAGAGGACATCTTATGGTGCACTGAAATGGAAAG
gtacccgggttgtgctggcatctggctgcggtgtggctgttctgattgctgtgcttgctg
cgggggtcctctgcctttcccacctgacttgttttccacaaacgtcctgggaacagtggg
ttttatcaagcatttcccaacatggcagactcctggggtggactcctgacaccccaggct
EXON 23  1444 bp
aaaggacagaagattcggcagaactaagcaggcgtcagaggagttggtgggtgtgagtgc
ccctgtccctgcacttcgggtggctgctggtcctccgggtcctgctgtgtggttagacgg
cttccgggcagcctggtctggccagcactcaccctgccctctctgccttttctcccccag
GGTATTTGGTTTCCCAGTCCACTATACTGACGTCTCCAACATGAGCCGCTTGGCGAGGCA
GAGACTGCTGGGCCGGTCATGGAGCGTGCCAGTCATCCGCCACCTCTTCGCTCCGCTGAA
GGAGTATTTTGCGTGTGTGTAAGGGACATGGGGGCAAACTGAGGTAGCGACACAAAGTTA
AACAAACAAACAAAAAACACAAAACATAATAAAACACCAAGAACATGAGGATGGAGAGAA
GTATCAGCACCCAGAAGAGAAAAAGGAATTTAAAACAAAAACCACAGAGGCGGAAATACC
GGAGGGCTTTGCCTTGCGAAAAGGGTTGGACATCATCTCCTGATTTTTCAATGTTATTCT
TCAGTCCTATTTAAAAACAAAACCAAGCTCCCTTCCCTTCCTCCCCCTTCCCTTTTTTTT
CGGTCAGACCTTTTATTTTCTACTCTTTTCAGAGGGGTTTTCTGTTTGTTTGGGTTTTGT
TTCTTGCTGTGACTGAAACAAGAAGGTTATTGCAGCAAAAATCAGTAACAAAAAATAGTA
ACAATACCTTGCAGAGGAAAGGTGGGAGAGAGGAAAAAAGGAAATTCTATAGAAATCTAT
ATATTGGGTTGTTTTTTTTTTTGTTTTTTGTTTTTTTTTTTTGGGTTTTTTTTTTTACTA
TATATCTTTTTTTTGTTGTCTCTAGCCTGATCAGATAGGAGCACAAGCAGGGGACGGAAA
GAGAGAGACACTCAGGCGGCAGCATTCCCTCCCAGCCACTGAGCTGTCGTGCCAGCACCA
TTCCTGGTCACGCAAAACAGAACCCAGTTAGCAGCAGGGAGACGAGAACACCACACAAGA
CATTTTTCTACAGTATTTCAGGTGCCTACCACACAGGAAACCTTGAAGAAAATCAGTTTC
TAGAAGCCGCTGTTACCTCTTGTTTACAGTTTATATATATATGATAGATATGAGATATAT
ATATAAAAGGTACTGTTAACTACTGTACAACCCGACTTCATAATGGTGCTTTCAAACAGC
GAGATGAGTAAAAACATCAGCTTCCACGTTGCCTTCTGCGCAAAGGGTTTCACCAAGGAT
GGAGAAAGGGAGACAGCTTGCAGATGGCGCGTTCTCACGGTGGGCTCTTCCCCTTGGTTT
GTAACGAAGTGAAGGAGGAGAACTTGGGAGCCAGGTTCTCCCTGCCAAAAAGGGGGCTAG
ATGAGGTGGTCGGGCCCGTGGACAGCTGAGAGTGGGATTCATCCAGACTCATGCAATAAC
CCTTTGATTGTTTTCTAAAAGGAGACTCCCTCGGCAAGATGGCAGAGGGTACGGAGTCTT
CAGGCCCAGTTTCTCACTTTAGCCAATTCGAGGGCTCCTTGTGGTGGGATCAGAACTAAT
CCAGAGTGTGGGAAAGTGACAGTCAAAACCCCACCTGGAGCAAATAAAAAAACATACAAA
ACGT
actggtgctttcctgtctaagtcgccttttgtgtgttcttttatgaggcccccaccatcc
acccctctgtgcacaaggcggctcccggcccctggaatgtgatgtttttggtcatctcca
aaggctgcagttttatactgggaggctgatgacaccttttattataattattcttatggt