Gene DNAJB2 Variant 1
DNA : 7.52 KbNT_005403
mRNA : 2993 bp NM_006736
CDS : 975 bp NP_006727
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  143 bp
agcgcttctcgcttggatggaggcggggccgcagtctcccaggtcccagctggggctgac
gtcgtcctggtgtgtgcccaaaatagccggctccgccctcttctcccggcagcccctgca
ggcccccacccccccaggggacaggcggagccggccttctccccgtctctagtagtttcc
GCACCGCTGACGCATGCCTGCGCGCACAGCTGGGCCGGGCGCGTCCTACGCAGCAGCCGC
GAGCCGGGCTGCGGGTGCCAGACGGTTCCCGGCGGGGGGCAGGGGCGGGGCGCCGCAGGA
GGCCGGGACTCCTGGCGGAGGAG
gtgcggccgggggcccgggtcaggctgggggccctggatcggactgctggagttgggggg
ccccgatagggctcctgggcctgggcgtcgagatagctcttggccccggcctgcgggggc
agataaggctgccggagggagcctagtcaccggccgcaagcagagcccggtgtgctccgc
EXON 2  101 bp
ttggccccggcctgcgggggcagataaggctgccggagggagcctagtcaccggccgcaa
gcagagcccggtgtgctccgcttccaactgggagcgccttccgccacccggggaggggga
ctgctgcagccacagggtggggctcttggttctttccgcctgactccttctcttctgcag
CCCCAAGGAGGCCCGCCTGACGACTGACCAGTTGCCATGGCATCCTACTACGAGATCCTA
GACGTGCCGCGAAGTGCGTCCGCTGATGACATCAAGAAGGC
gtaagtgcctccgtatgcaacagaagacctctcaccctccacccgccaccaccatggggc
acttcagagtgacacctgtaggtgtctgagggaaccaggtcgttagaaagcactggggtg
cttcttccgagtgacacctgcagggaggaaagagacccctggtagagtacaaggagaacg
EXON 3  110 bp
gagagagggtggaacttgatgaaaatatcacagcagcggcagccctagcagctggggtgg
actgggacccgggggtgaaaggacagtgataggctaatgggaaaacaggtcgttcggttc
ctgggtgggaagtgcctgcatttgtcccccgactctctcctctgcacccactttctgcag
GTATCGGCGCAAGGCTCTCCAGTGGCACCCAGACAAAAACCCAGATAATAAAGAGTTTGC
TGAGAAGAAATTTAAGGAGGTGGCCGAGGCATATGAAGTGCTGTCTGACA
gtaagggccggggtcaggcaggacccagcacatcaccccctacttcatgccccagctcac
attttcttaaagcaatgtctctgccacctagtttcctctgtgcctttttccagcctgaca
tttaagctcccccctcccacagggacagctcagtgtctgctccccagagtctggtaggag
EXON 4  54 bp
tgtgtgaaaggctgagttgctgcctaaacctatagcccgtgtcccctgggtcccctgctg
tgcctgctttcccccgccaagtgtcagagtgtcagtctctggacaatcctttgaacgtcc
tagcctgggaggggagcccatcccagagggagggtgaaatgatctggtctctttttgcag
AGCACAAGCGGGAGATTTACGACCGCTATGGCCGGGAAGGGCTGACAGGGACAG
gtaggtggagtggtgaggcccaggaatggaggtggggcagggaggagaggggcagggcag
attcttgcaatggaggctctctcaggctcctggctgtgccttaggtgaggtcccccgctc
agggcaggatgcatgccctaagctctctcctcatcctgcctttccaggaactggcccatc
EXON 5  123 bp
ctgacagggacaggtaggtggagtggtgaggcccaggaatggaggtggggcagggaggag
aggggcagggcagattcttgcaatggaggctctctcaggctcctggctgtgccttaggtg
aggtcccccgctcagggcaggatgcatgccctaagctctctcctcatcctgcctttccag
GAACTGGCCCATCTCGGGCAGAAGCTGGCAGTGGTGGGCCTGGCTTCACCTTCACCTTCC
GCAGCCCCGAGGAGGTCTTCCGGGAATTCTTTGGGAGTGGAGACCCTTTTGCAGAGCTCT
TTG
gtgagtggactctggaagcctctgaatggctcaacttccccctccaggcctgtccttcca
tcagctgggaggccctgaggtggaaggctgagaggggacgggaatgccacggacagaaga
ttttgtggagctgggtccagtgagagccgggacagaacctcacgtgtgccagaacccccg
EXON 6  93 bp
aaccagtgagtgttttcgaattcaacattaaaaaggaatttataaataagcccaactaaa
aagcggaaaagaaaaaccctacccagttgcttagtggtttatacttccagacttgggctc
acacacttttgaggggaaatgtcattaccagatgactgctaatctgtttacttgttgcag
ATGACCTGGGCCCCTTCTCAGAGCTTCAGAACCGGGGTTCCCGACACTCAGGCCCCTTCT
TTACCTTCTCTTCCTCCTTCCCTGGGCACTCCG
gtaagttctgccccttcccacgtttgcaagctccgattcctggaacccctggcttgagct
tgttgcttttccaagcctgtctcctgtgttgggagccctgcctccagcagccctgcgagg
cggcctggagcctcggtgaccacaacaggcagcgcagtcttcttctaaccacctctcctc
EXON 7  103 bp
ttgcaagctccgattcctggaacccctggcttgagcttgttgcttttccaagcctgtctc
ctgtgttgggagccctgcctccagcagccctgcgaggcggcctggagcctcggtgaccac
aacaggcagcgcagtcttcttctaaccacctctcctcctcctcccttgtcccgatgccag
ATTTCTCCTCCTCATCTTTCTCCTTCAGTCCTGGGGCTGGTGCTTTTCGCTCTGTTTCTA
CATCTACCACCTTTGTCCAAGGACGCCGCATCACCACACGCAG
gtgagagctccttctggggccatagaggggtgagaggtctgctggggagctgtgttcaaa
tagaaagttggctccttgagggcagggcccagtctgcgctctctactgcggtggccagaa
ctgggaccagcgcctgcaggattctgtcactgctcgttgcctgaactgtgctgtctccca
EXON 8  71 bp
agagctccttctggggccatagaggggtgagaggtctgctggggagctgtgttcaaatag
aaagttggctccttgagggcagggcccagtctgcgctctctactgcggtggccagaactg
ggaccagcgcctgcaggattctgtcactgctcgttgcctgaactgtgctgtctcccacag
AATCATGGAGAACGGGCAGGAGCGGGTGGAAGTGGAGGAGGATGGGCAGCTGAAGTCAGT
CACAATCAATG
gtgaggagcagctcccctacccagcccctggcaggaagccccagccccaacctcagcagc
ctcctccccaaactgctgctctctgaactcacttagggcttgggagggagtggcaacagg
ccagactggtaggatcagagatggcaatgtcgggaagggggtgaaggagtctcacgaagc
EXON 9  1733 bp
tctacctggtagagctgaatacttccttgtgctcaaaatcacaagcctaggtgccaaaat
gcatgtgtgccaattccaaataagagactctaagtggtcagggttgttactgtgtgaggc
agcctggcagtaatacccctggctcaggttggggcctcatggtggctgtgactcttgcag
GTGTCCCAGATGACCTGGCACTGGGCTTGGAGCTGAGCCGTCGCGAGCAGCAGCCGTCAG
TCACTTCCAGGTCTGGGGGCACTCAGGTCCAGCAGACCCCTGCCTCATGCCCCTTGGACA
GCGACCTCTCTGAGGATGAGGACCTGCAGCTGGCCATGGCCTACAGCCTGTCAGAGATGG
AGGCAGCTGGGAAGAAACCCGCAGGTGGGCGGGAGGCACAGCACCGACGGCAGGGGCGGC
CCAAGGCCCAGCACCAAGATCCAGGCTTGGGGGGGACCCAGGAGGGTGCGAGGGGTGAAG
CAACCAAACGCAGTCCATCCCCAGAGGAGAAGGCCTCTCGCTGCCTCATCCTCTGAACAC
CGGGCCCAACCTGATCTGATCCAGATCTTGACTGGGGGGTCTGACTCACTGTGGGAAGAG
AAGAGGGGAGTATCCTGAGTTGTAGGAACTGCTTTCCAACTCCAAGCTCCCTCCACAAGT
TTCCCTCCCAGGCCCCCCACACCCCAGTGTGGACTTGGGATTTGCTGTGCTCAGCCCAGG
GCTGATAGGTCCCTGGTGAAGCCCAGGGTGGGGGGTGTCAGGGCAGTGGAGGGGCCCGAG
GAGCCAGGTTGCATTTATTGGATGGGGAGCTCCAAGGGGCATTAGTGGTTTGGGCTGGGC
CTTTTGTGCCCTGGTACTCTGCCACCTGTGTTGCTGATGGTGTCAAGGAAGGAGGACTTG
GCCTAGGGTTGTCTGAGCCGGAGCCGGCAGCTCCACTGGAGAGCAGTGCAGGCAGAGTGG
AGCCTCCTGCTCTCCTGGACCAGCTGCAGACCCCCAACCCTGGTTTCTGTGCCATGTTGC
GCTCTGACCGTCTCTGTTGCTTCTCTTCTGGTGTTGCTTCTCCTCCCTCCCATTCTCTCT
GCAACTCCCTGCGGGCCGCATCGCTTGCTTTCACTGCCGTCTGGCTAGGACTCCCTTCTT
CCTTCCTTCCCCGAGAAGGCCTCAATGTGGCGAGGAAGATGCTGGGGCCGGTAGGGCTGT
GAGATCTTCTGGGGAGGCTAGCCGGGTGGGGCGGGAGCCTCTCAGCTGTCCAGATTCAGA
ACTGGAGCCCACTCCTCCTCCCTCTCGTTGCCTCAGCCTGCCCTCACCCTCAGGACTAGG
CAGAGGTGAGGCTGGCTCACCCTGAAGAGGTGGGATAGGACCGGGGGACCCCAGAGGGAG
GCCTAGGAGGGGACTGCACCCATACTGCTTCCCTACCACAAATCAGGGCTCAGGGAGAGG
CCATGCGGCCAGCCCAGGTCTGCATGCTGAGCCCCATCCTCCACAGCTTGCCGCTGACGC
TCTCTCCTGTCACCCCGCCCCTGCTCTCTCCCCAGATGTGTTCTGAGCTGGATGCCGGGT
TCCAGAATCGCTGCACAGTTCCAACAGGACAGCGCCTTCCCCCATGCGCTGGGAGGGGAC
CCTCCATTTCTCCCCCTCACCCATGCTGAGTGTAGAGCCGGGGCCTGGGTGGCGGGTGGG
GGCCGGGTGGGAGGTGGCAGTAGTCTTAGCCTGTGCACTCTCTTCCTTGGGTGTTTGGTG
CTGGCTCCTGGGGACTACAAATCCCAGAGTGCGGTGTGCCCGGCCTCATTTCTGATAGAT
CCCGCTTGGGGGAGGTGGTGTATGGTTACGGAGCTGTGCATCTTGGGACATGTAGTAGCC
CAGGTCGGCTTGTCACTCGCTGTGAGATGGGGAGATTTTGTCTTTTGATTTAT
ccctgtagggctggcagggttgtagatgaagggggaatgatctgagccttggttcccctg
acacgtcttgctagccccagggttagagtgggcagggcagagccgcgcagcacctgggag
cggtacctttcccttgggcagcctggggtcccaggaacaagccagggcgagtggcatgtc
EXON 10  462 bp
gggggaggtggtgtatggttacggagctgtgcatcttgggacatgtagtagcccaggtcg
gcttgtcactcgctgtgagatggggagattttgtcttttgatttatccctgtagggctgg
cagggttgtagatgaagggggaatgatctgagccttggttcccctgacacgtcttgctag
CCCCAGGGTTAGAGTGGGCAGGGCAGAGCCGCGCAGCACCTGGGAGCGGTACCTTTCCCT
TGGGCAGCCTGGGGTCCCAGGAACAAGCCAGGGCGAGTGGCATGTCTGCCTGAGCAGGGT
GTGGCCCCAGAAAGCTGAGGAGTGTGGGCTGGCAGAGAGCTTCGAGGGCAAGGCCACCCG
CGGGGGCGTGTGTGTGGTGGGGCTTGGCATGTGATGGCAGCTCCAGGCATGCCGCTGCTT
GTATGGCTTTCTTTGGCCTCTGACCCTGCTGCCCATTCTTTCCAACATCACAGATGAACT
GCCTCTCCTCCTCCCTGCCTGGGGAGCCCAGTGGCCAGGGAGGGGAGTGGTGGAGCCAGT
CGCTGTAACACTGAGCCTCAGAGACGAACCAAAACCAGCTGGGCTGAGCTCAGATCCAGG
GGGAAATGCTGGAAGTCAATAAAACTGAGTTTTGAGAGCTTG
gtggtgtgttgtgttcttgggttcctactttccggggtggcccaggagggcctctaaggg
acagtgggtgacacctcaggcctcacacctccctttatgcccctacagctagaggtgcag
gccttgccagttgaaggcagaaatgccctctttgaccaggctgccctccccaggtatgtt