Gene DCTN1 Variant 2
DNA : 13.20 KbNT_022184
mRNA : 3779 bp NM_023019
CDS : 3435 bp NP_075408
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  30 bp
gccgcaccgggaggctgagactgcattgttgggatttgatgcactaatctcctgtctccg
ccgcctttccctctgttcggtctcttgccctccctcccttcgtctgtccttcctccgtgt
gtttgtctatcctcctctgtccctcctctttcctctccttgctttctttggttttctgca
ATGATGAGACAGGCACCGACAGCCCGAAAG
gtactcttgcttgctctcgtcctgctgctgggttgccagggcaatggtggcagcaggctg
ctggggtgggggtgggggctgattgacttcatctgtctacctggtcggggaggcgggtga
ggacgaaggtgggttagggagaggtgtgtgtcaccactatgccccacaccctgggcattt
EXON 2  21 bp
agtaggaatacagtgattcactgaagggagaaggggatgggatgggggggagggtggcta
actgtagccccattcctgttatttcttctgctctcattgctgtcccttttgctctctgtc
tttctgccattgtcctttctttcctgactacttctcttctggctcctgttgcctgtccag
ACCACAACTCGGCGACCCAAG
gtgagaaaacaggcccctgtgtgagccactgctgagtgtacacacacgtttcaggcatgt
ggatgtatgagggcacgtgtatgagcaagtgaaagttcgtcatagtgtatcctgggttct
cttcagaggaaagggtgggggttcgcagtgctggcaggcacctcctggggaaaatggctt
EXON 3  192 bp
ctctgtatcattttccttgtccccttcattcttcttttctcactgtgctttgatactctc
tttctgctttttcccttttctgtctccttcccttgccatattctcatattctgtttctgt
tcctcttactacccctatcctctgctttctttctggtctgcctctaccctttctgaatag
CCCACGCGCCCAGCCAGTACTGGGGTGGCTGGGGCCAGTAGCTCCCTGGGCCCCTCTGGC
TCAGCGTCAGCAGGTGAGCTGAGCAGCAGTGAGCCCAGCACCCCGGCTCAGACTCCGCTG
GCAGCACCCATCATCCCCACGCCGGTCCTCACCTCTCCTGGAGCAGTCCCCCCGCTTCCT
TCCCCATCCAAG
gtaaggcctggggtaggggtaaaggagaatcaagacacccagaggcttgtggctacccgc
tgtgtcttgaaaatttcctggggttggcaaagacctagaacttggatcagaaagggtgag
gacatagcctatggatatcttgctactgactgagccatcctttcctttcttgcccttatg
EXON 4  198 bp
ccatactttccccatatatactgtgctacggtttcctctcagatgttcttatgccactga
ctgttggccaccctggggctgggtgatgtttgcacactttcttgtgttctttgcgccagc
tcagtgttggtggagaggaggagtgggctgtgcacagaccgtgaggcctctcctttgcag
GAGGAGGAGGGACTAAGGGCTCAGGTGCGGGACCTGGAGGAGAAACTAGAGACCCTGAGA
CTGAAACGGGCAGAAGACAAAGCAAAGCTAAAAGAGCTGGAGAAACACAAAATCCAGCTG
GAGCAGGTGCAGGAATGGAAGAGCAAAATGCAGGAGCAGCAGGCCGACCTGCAGCGGCGC
CTCAAGGAGGCGAGAAAG
gtttgactctggatgaagggggtggctggggcagcctgagacctaaggaagcatgctgga
aactagactggagctggagcctggaacatactgtgagaaaggcctggggcatctctgtgc
tggtaccccctcccacctccacttcttcctcaggaagccaaggaggcgctggaggcaaag
EXON 5  205 bp
cagcggcgcctcaaggaggcgagaaaggtttgactctggatgaagggggtggctggggca
gcctgagacctaaggaagcatgctggaaactagactggagctggagcctggaacatactg
tgagaaaggcctggggcatctctgtgctggtaccccctcccacctccacttcttcctcag
GAAGCCAAGGAGGCGCTGGAGGCAAAGGAACGCTATATGGAGGAGATGGCTGATACTGCT
GATGCCATTGAGATGGCCACTTTGGACAAGGAGATGGCTGAAGAGCGGGCTGAGTCCCTG
CAGCAGGAGGTGGAGGCACTGAAGGAGCGGGTGGACGAGCTCACTACTGACTTAGAGATC
CTCAAGGCTGAGATTGAAGAGAAGG
gtaaggggcccacagctgctgggggccaaacggtcaggtgagaaccatgcctgaaagtgt
taatgatcttctccaggctcagatggcgctgcatccagttatcagctcaagcagcttgag
gagcagaatgcccgcctgaaggatgccctggtgaggtagggtcttcagtgcttgcctctg
EXON 6  79 bp
agagcgggctgagtccctgcagcaggaggtggaggcactgaaggagcgggtggacgagct
cactactgacttagagatcctcaaggctgagattgaagagaagggtaaggggcccacagc
tgctgggggccaaacggtcaggtgagaaccatgcctgaaagtgttaatgatcttctccag
GCTCAGATGGCGCTGCATCCAGTTATCAGCTCAAGCAGCTTGAGGAGCAGAATGCCCGCC
TGAAGGATGCCCTGGTGAG
gtagggtcttcagtgcttgcctctgatgcttactcttgtgtctccaaatgtgttagagca
cccatcgccagagactctgacacgtgctttcctccttctgccttcctcacatccctgcag
gatgcgggatctttcttcctcagagaagcaggagcatgtgaagctccagaagctcatgga
EXON 7  160 bp
cagttatcagctcaagcagcttgaggagcagaatgcccgcctgaaggatgccctggtgag
gtagggtcttcagtgcttgcctctgatgcttactcttgtgtctccaaatgtgttagagca
cccatcgccagagactctgacacgtgctttcctccttctgccttcctcacatccctgcag
GATGCGGGATCTTTCTTCCTCAGAGAAGCAGGAGCATGTGAAGCTCCAGAAGCTCATGGA
AAAGAAGAACCAAGAGCTGGAAGTTGTGAGGCAACAGCGGGAGCGTCTGCAGGAGGAGCT
AAGCCAGGCAGAGAGCACCATTGATGAGCTCAAGGAGCAG
gtctggggagcccagcccctcacccagaatcccccacctgactctcctatcagttgatgc
ctcctctttctaggtaccttccagcagcccttctccctatcctccccgtaacacaggtgg
atgctgctctgggtgctgaggagatggtggagatgctgacagatcggaacctgaatctgg
EXON 8  105 bp
gcgggagcgtctgcaggaggagctaagccaggcagagagcaccattgatgagctcaagga
gcaggtctggggagcccagcccctcacccagaatcccccacctgactctcctatcagttg
atgcctcctctttctaggtaccttccagcagcccttctccctatcctccccgtaacacag
GTGGATGCTGCTCTGGGTGCTGAGGAGATGGTGGAGATGCTGACAGATCGGAACCTGAAT
CTGGAAGAGAAAGTGCGCGAGTTGAGGGAGACTGTGGGAGACTTG
gtaagagaagagcagacccctgacatctgacttggacctgctgagaaaaagattgacatg
tgacccttggcctttgagcagggtgtgcggtgagggacccagcctgggcttgctaccctg
accctgccttttttttttttttttttttctgagatggaatctcgctctgttgccaggctg
EXON 9  192 bp
ccagctaatttttgtatttttagtagagatggggtttcaccatgttggccagcatgatct
cgatctcgacctcatgatccgcctgctttgacctcccaaagtgctgggattacaggtgtg
aaccaccgccgctggccgaccctgcctttctttagcccaaactatggtgtggtgtcctag
GAAGCGATGAATGAGATGAACGATGAGCTGCAGGAGAATGCACGTGAGACAGAACTGGAG
CTGCGGGAGCAGCTGGACATGGCAGGCGCGCGGGTTCGTGAGGCCCAGAAGCGTGTGGAG
GCAGCCCAGGAGACGGTTGCAGACTACCAGCAGACCATCAAGAAGTACCGCCAGCTGACC
GCCCATCTACAG
gtacatgcccactgtttgctctctgcccaccatcaccccagggcttccttatgacccagc
tgtgcttcactgtctctcctcctaggatgtgaatcgggaactgacaaaccagcaggaagc
atctgtggagaggcaacagcagccacctccagagacctttgacttcaaaatcaagtttgc
EXON 10  117 bp
gtgaggcccagaagcgtgtggaggcagcccaggagacggttgcagactaccagcagacca
tcaagaagtaccgccagctgaccgcccatctacaggtacatgcccactgtttgctctctg
cccaccatcaccccagggcttccttatgacccagctgtgcttcactgtctctcctcctag
GATGTGAATCGGGAACTGACAAACCAGCAGGAAGCATCTGTGGAGAGGCAACAGCAGCCA
CCTCCAGAGACCTTTGACTTCAAAATCAAGTTTGCTGAGACTAAGGCCCATGCCAAG
gtcaggaaagtgtgtgggtctgagggagccctgcctgggatgaactggtatggggtctgg
gcttcagattcctgggggaaggggtgctttgtgtggtggtttggaagactctggcctggg
cttgccctagaagcaagggatctactggagcaaggcatgggaattttggggctctttcag
EXON 11  153 bp
ggatgaactggtatggggtctgggcttcagattcctgggggaaggggtgctttgtgtggt
ggtttggaagactctggcctgggcttgccctagaagcaagggatctactggagcaaggca
tgggaattttggggctctttcagctctggctaagagtcctcctccctgttcacctcacag
GCAATTGAGATGGAATTGAGGCAGATGGAGGTGGCCCAGGCCAATCGACACATGTCCCTG
CTGACAGCCTTCATGCCTGACAGCTTCCTTCGGCCAGGTGGGGACCATGACTGCGTTCTG
GTGCTGTTGCTCATGCCTCGTCTCATTTGCAAG
gtatggccaatcaatcacatgttccacagaaatctagtgaacttgccatgaaccaggcat
tgaagatgctgagtgaagacaacagagtctctgcccacaaagagtttatggtatagtgga
ggaacacagcaaagtcaccgattaatatatattacaaatggtgtgttttcaaggagagat
EXON 12  161 bp
gtaatcacatcactaccctttccccatgcaagattccccacccaggtaagagctatttct
gctttctctcccatgtgtgtccatgctccccacatagttaagctctgagtactatattcc
tgagtctctgttctccatcctctgctctgaggcccaggttcctggtgctttttcccacag
GCAGAGCTGATCCGGAAGCAGGCCCAGGAGAAGTTTGAACTAAGTGAGAACTGTTCAGAG
CGGCCTGGGCTGCGAGGAGCTGCTGGGGAGCAACTCAGCTTTGCTGCTGGACTGGTGTAC
TCGCTGAGCCTGCTGCAGGCCACGCTACACCGCTATGAGCA
gtaagtgactcctgactccctcaccccagggtgggggtccaggattggccagaactgaga
ttgcctggcagactctagcctcacagtgcccttctctggtctctagtgccctctctcagt
gcagtgtggatgtgtataagaaagtgggcagcctgtaccctgagatgagtgcccatgagc
EXON 13  169 bp
gagcaactcagctttgctgctggactggtgtactcgctgagcctgctgcaggccacgcta
caccgctatgagcagtaagtgactcctgactccctcaccccagggtgggggtccaggatt
ggccagaactgagattgcctggcagactctagcctcacagtgcccttctctggtctctag
TGCCCTCTCTCAGTGCAGTGTGGATGTGTATAAGAAAGTGGGCAGCCTGTACCCTGAGAT
GAGTGCCCATGAGCGCTCCTTGGATTTCCTCATTGAACTGCTGCACAAGGATCAGCTGGA
TGAGACTGTCAATGTGGAGCCTCTCACCAAGGCCATCAAGTACTATCAG
gtgtggggcaagaatttgggcttggggcaggaggcagggaagctttcacttgatgggggc
tcttactaatatattcaaggttgtatgtcccatgcttgctgcttgaggcctggtttgctc
ttagatgaactctccatatgatgcagctgcttgagggctttggattctcttgtacctcca
EXON 14  69 bp
ttgctgcttgaggcctggtttgctcttagatgaactctccatatgatgcagctgcttgag
ggctttggattctcttgtacctccagagacccatgatgaccagggctcaaactacagttt
gggaagaactccccacccgctccagggcctaaaagttgtctgtctgttatctctcctcag
CATCTGTACAGCATCCACCTTGCCGAACAGCCTGAGGACTGTACTATGCAGCTGGCTGAC
CACATTAAG
gtgaagtatctgggccagtgattgagcccccgtggagatcagaaatggagggcatcaggt
caagagatcaggcacccaagaagtgtcacataagactagggcagagttaccaaagccata
tcagggaaactagaggacctacttatgtatgggggtcagcagaggatggggacttcttag
EXON 15  63 bp
agatcaggcacccaagaagtgtcacataagactagggcagagttaccaaagccatatcag
ggaaactagaggacctacttatgtatgggggtcagcagaggatggggacttcttagagat
gttgataaggcagaagggctcctgctgggggctgatgattgcatgcttctatcctcacag
TTCACGCAGAGTGCTCTGGACTGCATGAGTGTGGAGGTAGGACGGCTGCGTGCCTTCTTG
CAG
gtgagaacacatctagatctgtgtgagctcctcttctttcttagtcctcacttccttact
ccgagccttaatgctaacttggttctccatccattttctttttcctgagtagggtgggca
ggaggctacagatattgccctcctgctccgggatctggaaacttcatgcagtgacatccg
EXON 16  150 bp
cacagttcacgcagagtgctctggactgcatgagtgtggaggtaggacggctgcgtgcct
tcttgcaggtgagaacacatctagatctgtgtgagctcctcttctttcttagtcctcact
tccttactccgagccttaatgctaacttggttctccatccattttctttttcctgagtag
GGTGGGCAGGAGGCTACAGATATTGCCCTCCTGCTCCGGGATCTGGAAACTTCATGCAGT
GACATCCGCCAGTTCTGCAAGAAGATCCGAAGGCGAATGCCAGGGACAGATGCTCCTGGG
ATCCCAGCTGCACTGGCCTTTGGACCACAG
gtttaaggctgcaactggggaagggaaggaaactgagtagaaacatgaagggtatagcac
ttgaagatctggatctggttaggggacaaaaatggttttggggtagctggaaactgtggt
gctgaacccagggttgactcctgactctggcctggcacacaggtatctgacacgctccta
EXON 17  162 bp
ctggcctttggaccacaggtttaaggctgcaactggggaagggaaggaaactgagtagaa
acatgaagggtatagcacttgaagatctggatctggttaggggacaaaaatggttttggg
gtagctggaaactgtggtgctgaacccagggttgactcctgactctggcctggcacacag
GTATCTGACACGCTCCTAGACTGCAGGAAACACTTGACGTGGGTCGTGGCTGTGCTGCAG
GAGGTGGCAGCTGCTGCTGCCCAGCTCATTGCCCCACTGGCAGAGAATGAGGGGCTACTT
GTGGCTGCTCTGGAGGAACTGGCTTTCAAAGCAAGCGAGCAG
gtgggcctggatggctgggtagaaggtgtggggagagttagtgaccagtgtggggctttt
acttctgcccttggctcctgcagatctatgggaccccctccagcagcccctatgagtgtc
tgcgccagtcatgcaacatcctcatcagtaccatgaacaagctggccacagccatgcagg
EXON 18  132 bp
ggcagctgctgctgcccagctcattgccccactggcagagaatgaggggctacttgtggc
tgctctggaggaactggctttcaaagcaagcgagcaggtgggcctggatggctgggtaga
aggtgtggggagagttagtgaccagtgtggggcttttacttctgcccttggctcctgcag
ATCTATGGGACCCCCTCCAGCAGCCCCTATGAGTGTCTGCGCCAGTCATGCAACATCCTC
ATCAGTACCATGAACAAGCTGGCCACAGCCATGCAGGAGGGGGAGTATGATGCAGAGCGG
CCCCCCAGCAAG
gtaggtggagatttccttggagaagttgcagaggcctgtaggagtaagacttgcagagct
actgctagttgtgggaggacggggagacaggaggaaggcatctggagagcaccatcctgc
ctagaaggcagggttttccctgtaactggatctctctgtaaggagcacagtgatgatctc
EXON 19  126 bp
aagacttgcagagctactgctagttgtgggaggacggggagacaggaggaaggcatctgg
agagcaccatcctgcctagaaggcagggttttccctgtaactggatctctctgtaaggag
cacagtgatgatctcttctctccaccctcactttctcaccccctaccgaccattccttag
CCTCCACCGGTTGAACTGCGGGCTGCTGCCCTTCGTGCAGAGATCACAGATGCTGAAGGC
CTGGGTTTGAAGCTCGAAGATCGAGAGACAGTTATTAAGGAGTTGAAGAAGTCACTCAAG
ATTAAG
gtgagggtagtgtaggctcaggatctgggggccaggaaattggtaggactcaggaaagca
gtgagtgttggggatcgggaccaagacggcttgggagttaaggggagaagtggggcctgc
aatcaatgggagctgtggtgagccctcagggaacctactatctcatggtctagcccccag
EXON 20  143 bp
aagcagtgagtgttggggatcgggaccaagacggcttgggagttaaggggagaagtgggg
cctgcaatcaatgggagctgtggtgagccctcagggaacctactatctcatggtctagcc
cccagtttccagggactgtggggaggatgtcagggatctagaagttctgtccttgtccag
GGAGAGGAGCTAAGTGAGGCCAATGTGCGGCTGAGCCTCCTGGAGAAGAAGTTGGACAGT
GCTGCCAAGGATGCAGATGAGCGCATCGAGAAAGTCCAGACTCGGCTGGAGGAGACCCAG
GCACTGCTGCGAAAGAAGGAGAA
gtcaggcactttccctggggccttgcttcctctaatcctcccactgctggagctctctgc
ctcctaacccatacccctactcaggttctcttatagtgagactccccattttctttaccc
actgccaaccccattgcatcaccccagcctaagcctgtgctgctctgccctggcttctca
EXON 21  167 bp
tagtgagactccccattttctttacccactgccaaccccattgcatcaccccagcctaag
cctgtgctgctctgccctggcttctcactggcagggctattccaaggacctctcaggact
gaatagtcaaggagtgctttagagaagggacactgccaaagcccagattctctttcacag
AGAGTTTGAGGAGACAATGGATGCACTCCAGGCTGACATCGACCAGCTGGAGGCAGAGAA
GGCAGAACTAAAGCAGCGTCTGAACAGCCAGTCCAAACGCACGATTGAGGGACTCCGGGG
CCCTCCTCCTTCAGGCATTGCTACTCTGGTCTCTGGCATTGCTGGTG
gtgagtactgtggaataggcagcactagcacagaggagattgtcttctctcctgtccttg
gcctcattttgacctctgccccaccccccttacccccgggtattcagccaggaacatgct
tacacagtttcactctgtgccagttttcaccaagttttcccttccgctgaagatgtgtgc
EXON 22  15 bp
ttatctgctcgtccccaaagataggtggcagagagtcttgttagagaaagtatgatgatt
aggaaaagggttttcctgcaggttgtgtccaggattcctctggtgtgtccccgtaacccc
caaatcacctaactcctctctcctcttttcctgctcccccatgggctatcccgagcacag
AAGAACAGCAGCGAG
gtagagacccactctggccgggggttaccaggctggtgggagttggagctaagggagcag
ggtggagggggaagccaggactggagatgggtgatggggggatgaggaaaggggaagagt
aggaatggagcccaattttcaaccctttccacttggggctgatgagattttttatggtcc
EXON 23  134 bp
acccactctggccgggggttaccaggctggtgggagttggagctaagggagcagggtgga
gggggaagccaggactggagatgggtgatggggggatgaggaaaggggaagagtaggaat
ggagcccaattttcaaccctttccacttggggctgatgagattttttatggtccccacag
GAGCCATCCCTGGGCAGGCTCCAGGGTCTGTGCCAGGCCCAGGGCTGGTGAAGGACTCAC
CACTGCTGCTTCAGCAGATCTCTGCCATGAGGCTGCACATCTCCCAGCTCCAGCATGAGA
ACAGCATCCTCAAG
gtgagggagccacggggaggactgggatgggagatggagcatatttgccccattgatgat
agatgacaggggcctcctagcacctcttaccactatccttcttttttcatccacagggag
cccagatgaaggcatccttggcatccctgccccctctgcatgttgcaaagctatcccatg
EXON 24  184 bp
tcagcagatctctgccatgaggctgcacatctcccagctccagcatgagaacagcatcct
caaggtgagggagccacggggaggactgggatgggagatggagcatatttgccccattga
tgatagatgacaggggcctcctagcacctcttaccactatccttcttttttcatccacag
GGAGCCCAGATGAAGGCATCCTTGGCATCCCTGCCCCCTCTGCATGTTGCAAAGCTATCC
CATGAGGGCCCTGGCAGTGAGTTACCAGCTGGAGCGCTGTATCGTAAGACCAGCCAGCTG
CTGGAGACATTGAATCAATTGAGCACACACACGCACGTAGTAGACATCACTCGCACCAGC
CCTG
gtatgtacctgccaacccccaagatgaataaaactgccccctccacttggcccagggatt
tagcccctgctcaggtggttcccccaccacagaagctcttcccagcagtgttctttggct
tcactgttcagtttgtttgattcacccactctctctcaagtacttgttctgttagagagt
EXON 25  80 bp
caccacagaagctcttcccagcagtgttctttggcttcactgttcagtttgtttgattca
cccactctctctcaagtacttgttctgttagagagtcttatacctgcacccctaaccctt
aatccagtagaactgcctgcctgcgccttggtgggcctcaccagctttctctccccacag
CTGCCAAGAGCCCGTCGGCCCAACTTATGGAGCAAGTGGCTCAGCTTAAGTCCCTGAGTG
ACACCGTCGAGAAGCTCAAG
gtcagctcagtttgccaggcagagctcacttcacagcataaactggtggagccaggcact
tgtggagttcctctgagcccagccctgtgctagacagcaattggggaggagatggaaggg
aaggcagggttcttgccttggaagctcactgtctcagtgcaaacagaagacagattctca
EXON 26  90 bp
tgcaaagtaaggaggagtgctggtgtggggatggggttggagatgagagcaaaagtatgt
tgatatagaggactaagtccctgcccccctggtattagtgtctctgtgaaaccacgtggt
cttgtgctagcctgtgggggtcccataaatgaacccttgtcttcctctccccttccctag
GATGAGGTCCTCAAGGAGACAGTATCTCAGCGCCCTGGAGCCACAGTACCCACTGACTTT
GCCACCTTCCCTTCATCAGCCTTCCTCAGG
gtgagggggagcatggggtggaggatgggacagtgtggagagctcaggcgggcccccctc
tcctccagaattggaggaggcctttggagtctcaggtctaacaactgcataccttgggtt
atctggccaaattttacttacaagtaactcagaagtgcttacagtgctttgaaattccaa
EXON 27  482 bp
tcccttgtcagattatgtatccccattcttatttgaaaaatgtggtcacaatagcccagg
atctcagaagccctagtcacccaggagctgccttggtctcagtgctcagggaccccttca
gtggcccacagctcaagtgagcccctgacctggagtctttttctcctcatcaaccaccag
GCCAAGGAGGAGCAGCAGGATGACACAGTCTACATGGGCAAAGTGACCTTCTCATGTGCG
GCTGGTTTTGGACAGCGACACCGGCTGGTGCTGACCCAGGAGCAGCTGCACCAGCTTCAC
AGTCGCCTCATCTCCTAAGCACTCCTTTCCCCTGCTGTCCCCTTCGACCCTCAGCCCTCT
GGTGCCGCTCTGCCCGATGCACAGCCACCTCAGCCAGCCCCCAGGTAGAAACGTGGGTTA
AGCTCTTCCTGCCCCGTTCAGCTTCACTCCCACCCTTTCAGCGTCCTGCCCCTTCACCTT
GACCCGGGTTCCCCCACTCCCATTCCCTGGCCTCTGCCATAATTTGTTGTTCAACTGCTC
CCTCCTTCCTGAGGGGCCTCAGGGCTTGTGGGGGGTAGGCTGAGACCCCACCACCAAAGG
TTAAGTGAGGTCCCCTTGATTGAGGACTTCACCCCTTGATTAAAGCAACTTCTGCTTCAG
TG
cttcctgtgtggtgttgagagtgggacttgggccattaagctcacagcaggagtggagga
gaagcgatgctgaggaagctttggctgtatcaaatttgaggtctcctcttcgtagtgacc
agaagaatgctgtttctaaaattcatgtgcagtaagttactctaaccaaggaggaaaggg