Gene DCTN1 Variant 1
DNA : 19.68 KbNT_022184
mRNA : 4981 bp NM_004082
CDS : 3837 bp NP_004073
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  833 bp
aggcaaggccaagagtacaaggggcagatgactgaggtggactgggccttgtgctacaag
aagaaagaagggctctctgcttttgactactgcctttagtaatccagttgagtctgatac
tcttgtgttttacaacctggccccttataacaaccataaagggtgaagggtgactatggc
AACCTTTGCCAGCCTTGTGGGAGGGGGCTAGGGTACTTGGCTTGCTTTGCTATGTGTGTG
AAGTTGCCTTCATTACTGCCCTTCTCTTGCTGCCTCCTGGGCAGGGCCTGCCTCCTCTGG
CTCAGTGTGAGATTGAAATCCAGGCCCTACTCACATGAATTTGGACCCTGAGTCCAGAGT
TTAGAGAGGGGAGGGAGAGAGAAGAGCACCAGAAAGGTAGATGAGAGACCCTTATTTTGG
CTGTGTGGAGGCTCTAGGCAGCTGATCGCTTTGAAGTGTCACTTGATGCTTATGGGCCTG
CTGAGGCCTTACATCCTGGGGGAGAGGGGAACAGTGATGGTGAGTGGGTACAGACTAGGA
GGACGTGTCAAGACTGCTTCCAGCCCTAGGACAGTGTATTCAAGAGTTGAGTGCTGAGGG
TCTGTGGCGTATGCCCAGCCCTTAGTTTCTGGCCCACGTGAAGCAGGGGGGCACTAGGAC
CCAGAGGCTAGCACGGTTCCTGACAAGTCTAGAGCAGCACTAGCGCAGAGTGAGACTCAT
CAGCTGGCAAGCAGGATTCTGTGTCTCTGGGTTCAGGAATCCTCAGGCAGCAGAGGGGAC
TTGCTCCTCAGCCCCCATCACTGCCCCCACCCCTACCCGTGTAGGCCACCGAGTGAGGCC
CATGGACTGGGGAGGGCTGTGCCTGACGACTCCTGTGTCCCTCTATGAGGGCCCAGCGCC
CTGACCCTCCTGCCTAGGTTTCTACCTTTTCTCTCTGTCTTTGGCCAGCTGGGGGAGGGG
GTAGAGGCCGGGTGAGCAACATGGCACAGAGCAAGAGGCACGTGTACAGCCGG
gtaagtggccctaatctgggatggccctggagggctgctggggaaggcctggctgcctgt
ggacatcattgctgtgggggctggggagataggctggagctcagctgagggcactcagac
tgtgttttctaaggagccctcgaagccctggtggtgtaaggctggacaggcttcccttta
EXON 2  246 bp
atatcattggcattttttcaaaggggaatttgggggtccacccaattctgtaaatggggt
ttaagaaaatgactctggttgtttttcagtccagcatcttggctgaggcatttcttatac
ataagaatgccacctttgatctgaggcctctaactgtctgtgtttacctgtgtctttcag
ACGCCCAGCGGCAGCAGGATGAGTGCGGAGGCAAGCGCCCGGCCTCTGCGGGTGGGCTCC
CGTGTAGAGGTGATTGGAAAAGGCCACCGAGGCACTGTGGCCTATGTTGGAGCCACACTG
TTTGCCACTGGCAAATGGGTAGGCGTGATTCTGGATGAAGCAAAGGGCAAAAATGATGGA
ACTGTTCAAGGCAGGAAGTACTTCACTTGTGATGAAGGGCATGGCATCTTTGTGCGCCAG
TCCCAG
gtattcacgcccttcttttgtgtctgtgcatgtgtgcacatgtctgtcgcatgtgcagct
gatgtgttggtacttcgttttcctgagcatgggcataagcctctggttgggagagtggaa
ggtagtgggggagggaagattgaagatgcatccttagggaagctgccctgtactcttggt
EXON 3  79 bp
cataagcctctggttgggagagtggaaggtagtgggggagggaagattgaagatgcatcc
ttagggaagctgccctgtactcttggtttgcttggagcctggggaggggcccatattaca
gccgtccttgatctggctatattgaaactattgatctggctatattgaatctggcctcag
ATCCAGGTATTTGAAGATGGAGCAGATACTACTTCCCCAGAGACACCTGATTCTTCTGCT
TCAAAAGTCCTCAAAAGAG
gtaacaaccacccacttaaagttgcctccccatagccaggaggagtccccaggacttctc
ctcataacatggggccacagtagatcctaagatttttttccgtcactaccatattccctt
attatatctccccctacctctctatacaagtacacactttgtttctgtttgctttctaca
EXON 4  35 bp
taacaaccacccacttaaagttgcctccccatagccaggaggagtccccaggacttctcc
tcataacatggggccacagtagatcctaagatttttttccgtcactaccatattccctta
ttatatctccccctacctctctatacaagtacacactttgtttctgtttgctttctacag
AGGGAACTGATACAACTGCAAAGACTAGCAAACTG
gtgagtgatttgggggtgggaatggggaataataaagggaggggaaggagaaagaggagg
gatacccagtgctaggcaggtagaagtagtaggtgagtctgatttgccttctagtctctc
caacttccctaagaaggaggctttctggggattaattgctgtgttagagttacagtaaag
EXON 5  21 bp
agactctgcagcttctctgggccaaggtgtgaacatcctggaagctgatctttgaggggc
tactcatctcaccctgactcccccctacccgcgtctaacctgtgtaagcccgagttggtc
ttaacacctatgcccaggacatctgttctctaactctgccctttcctactcctcatgcag
CGGGGACTGAAGCCTAAGAAG
gtggtgtgtttactatttgtgcctgggtggatgggggccatgagccccttccccagctgt
cctgcatgtccctgggctgctgcatgcatgtgtgtgtgaccttgggctgggatggccaga
ggaaatggtggccttggctttcagagttcctttgaagggtgcaagaacatcaggctcagt
EXON 6  18 bp
ggctgagactgcattgttgggatttgatgcactaatctcctgtctccgccgcctttccct
ctgttcggtctcttgccctccctcccttcgtctgtccttcctccgtgtgtttgtctatcc
tcctctgtccctcctctttcctctccttgctttctttggttttctgcaatgatgagacag
GCACCGACAGCCCGAAAG
gtactcttgcttgctctcgtcctgctgctgggttgccagggcaatggtggcagcaggctg
ctggggtgggggtgggggctgattgacttcatctgtctacctggtcggggaggcgggtga
ggacgaaggtgggttagggagaggtgtgtgtcaccactatgccccacaccctgggcattt
EXON 7  21 bp
agtaggaatacagtgattcactgaagggagaaggggatgggatgggggggagggtggcta
actgtagccccattcctgttatttcttctgctctcattgctgtcccttttgctctctgtc
tttctgccattgtcctttctttcctgactacttctcttctggctcctgttgcctgtccag
ACCACAACTCGGCGACCCAAG
gtgagaaaacaggcccctgtgtgagccactgctgagtgtacacacacgtttcaggcatgt
ggatgtatgagggcacgtgtatgagcaagtgaaagttcgtcatagtgtatcctgggttct
cttcagaggaaagggtgggggttcgcagtgctggcaggcacctcctggggaaaatggctt
EXON 8  192 bp
ctctgtatcattttccttgtccccttcattcttcttttctcactgtgctttgatactctc
tttctgctttttcccttttctgtctccttcccttgccatattctcatattctgtttctgt
tcctcttactacccctatcctctgctttctttctggtctgcctctaccctttctgaatag
CCCACGCGCCCAGCCAGTACTGGGGTGGCTGGGGCCAGTAGCTCCCTGGGCCCCTCTGGC
TCAGCGTCAGCAGGTGAGCTGAGCAGCAGTGAGCCCAGCACCCCGGCTCAGACTCCGCTG
GCAGCACCCATCATCCCCACGCCGGTCCTCACCTCTCCTGGAGCAGTCCCCCCGCTTCCT
TCCCCATCCAAG
gtaaggcctggggtaggggtaaaggagaatcaagacacccagaggcttgtggctacccgc
tgtgtcttgaaaatttcctggggttggcaaagacctagaacttggatcagaaagggtgag
gacatagcctatggatatcttgctactgactgagccatcctttcctttcttgcccttatg
EXON 9  198 bp
ccatactttccccatatatactgtgctacggtttcctctcagatgttcttatgccactga
ctgttggccaccctggggctgggtgatgtttgcacactttcttgtgttctttgcgccagc
tcagtgttggtggagaggaggagtgggctgtgcacagaccgtgaggcctctcctttgcag
GAGGAGGAGGGACTAAGGGCTCAGGTGCGGGACCTGGAGGAGAAACTAGAGACCCTGAGA
CTGAAACGGGCAGAAGACAAAGCAAAGCTAAAAGAGCTGGAGAAACACAAAATCCAGCTG
GAGCAGGTGCAGGAATGGAAGAGCAAAATGCAGGAGCAGCAGGCCGACCTGCAGCGGCGC
CTCAAGGAGGCGAGAAAG
gtttgactctggatgaagggggtggctggggcagcctgagacctaaggaagcatgctgga
aactagactggagctggagcctggaacatactgtgagaaaggcctggggcatctctgtgc
tggtaccccctcccacctccacttcttcctcaggaagccaaggaggcgctggaggcaaag
EXON 10  205 bp
cagcggcgcctcaaggaggcgagaaaggtttgactctggatgaagggggtggctggggca
gcctgagacctaaggaagcatgctggaaactagactggagctggagcctggaacatactg
tgagaaaggcctggggcatctctgtgctggtaccccctcccacctccacttcttcctcag
GAAGCCAAGGAGGCGCTGGAGGCAAAGGAACGCTATATGGAGGAGATGGCTGATACTGCT
GATGCCATTGAGATGGCCACTTTGGACAAGGAGATGGCTGAAGAGCGGGCTGAGTCCCTG
CAGCAGGAGGTGGAGGCACTGAAGGAGCGGGTGGACGAGCTCACTACTGACTTAGAGATC
CTCAAGGCTGAGATTGAAGAGAAGG
gtaaggggcccacagctgctgggggccaaacggtcaggtgagaaccatgcctgaaagtgt
taatgatcttctccaggctcagatggcgctgcatccagttatcagctcaagcagcttgag
gagcagaatgcccgcctgaaggatgccctggtgaggtagggtcttcagtgcttgcctctg
EXON 11  79 bp
agagcgggctgagtccctgcagcaggaggtggaggcactgaaggagcgggtggacgagct
cactactgacttagagatcctcaaggctgagattgaagagaagggtaaggggcccacagc
tgctgggggccaaacggtcaggtgagaaccatgcctgaaagtgttaatgatcttctccag
GCTCAGATGGCGCTGCATCCAGTTATCAGCTCAAGCAGCTTGAGGAGCAGAATGCCCGCC
TGAAGGATGCCCTGGTGAG
gtagggtcttcagtgcttgcctctgatgcttactcttgtgtctccaaatgtgttagagca
cccatcgccagagactctgacacgtgctttcctccttctgccttcctcacatccctgcag
gatgcgggatctttcttcctcagagaagcaggagcatgtgaagctccagaagctcatgga
EXON 12  160 bp
cagttatcagctcaagcagcttgaggagcagaatgcccgcctgaaggatgccctggtgag
gtagggtcttcagtgcttgcctctgatgcttactcttgtgtctccaaatgtgttagagca
cccatcgccagagactctgacacgtgctttcctccttctgccttcctcacatccctgcag
GATGCGGGATCTTTCTTCCTCAGAGAAGCAGGAGCATGTGAAGCTCCAGAAGCTCATGGA
AAAGAAGAACCAAGAGCTGGAAGTTGTGAGGCAACAGCGGGAGCGTCTGCAGGAGGAGCT
AAGCCAGGCAGAGAGCACCATTGATGAGCTCAAGGAGCAG
gtctggggagcccagcccctcacccagaatcccccacctgactctcctatcagttgatgc
ctcctctttctaggtaccttccagcagcccttctccctatcctccccgtaacacaggtgg
atgctgctctgggtgctgaggagatggtggagatgctgacagatcggaacctgaatctgg
EXON 13  105 bp
gcgggagcgtctgcaggaggagctaagccaggcagagagcaccattgatgagctcaagga
gcaggtctggggagcccagcccctcacccagaatcccccacctgactctcctatcagttg
atgcctcctctttctaggtaccttccagcagcccttctccctatcctccccgtaacacag
GTGGATGCTGCTCTGGGTGCTGAGGAGATGGTGGAGATGCTGACAGATCGGAACCTGAAT
CTGGAAGAGAAAGTGCGCGAGTTGAGGGAGACTGTGGGAGACTTG
gtaagagaagagcagacccctgacatctgacttggacctgctgagaaaaagattgacatg
tgacccttggcctttgagcagggtgtgcggtgagggacccagcctgggcttgctaccctg
accctgccttttttttttttttttttttctgagatggaatctcgctctgttgccaggctg
EXON 14  192 bp
ccagctaatttttgtatttttagtagagatggggtttcaccatgttggccagcatgatct
cgatctcgacctcatgatccgcctgctttgacctcccaaagtgctgggattacaggtgtg
aaccaccgccgctggccgaccctgcctttctttagcccaaactatggtgtggtgtcctag
GAAGCGATGAATGAGATGAACGATGAGCTGCAGGAGAATGCACGTGAGACAGAACTGGAG
CTGCGGGAGCAGCTGGACATGGCAGGCGCGCGGGTTCGTGAGGCCCAGAAGCGTGTGGAG
GCAGCCCAGGAGACGGTTGCAGACTACCAGCAGACCATCAAGAAGTACCGCCAGCTGACC
GCCCATCTACAG
gtacatgcccactgtttgctctctgcccaccatcaccccagggcttccttatgacccagc
tgtgcttcactgtctctcctcctaggatgtgaatcgggaactgacaaaccagcaggaagc
atctgtggagaggcaacagcagccacctccagagacctttgacttcaaaatcaagtttgc
EXON 15  117 bp
gtgaggcccagaagcgtgtggaggcagcccaggagacggttgcagactaccagcagacca
tcaagaagtaccgccagctgaccgcccatctacaggtacatgcccactgtttgctctctg
cccaccatcaccccagggcttccttatgacccagctgtgcttcactgtctctcctcctag
GATGTGAATCGGGAACTGACAAACCAGCAGGAAGCATCTGTGGAGAGGCAACAGCAGCCA
CCTCCAGAGACCTTTGACTTCAAAATCAAGTTTGCTGAGACTAAGGCCCATGCCAAG
gtcaggaaagtgtgtgggtctgagggagccctgcctgggatgaactggtatggggtctgg
gcttcagattcctgggggaaggggtgctttgtgtggtggtttggaagactctggcctggg
cttgccctagaagcaagggatctactggagcaaggcatgggaattttggggctctttcag
EXON 16  153 bp
ggatgaactggtatggggtctgggcttcagattcctgggggaaggggtgctttgtgtggt
ggtttggaagactctggcctgggcttgccctagaagcaagggatctactggagcaaggca
tgggaattttggggctctttcagctctggctaagagtcctcctccctgttcacctcacag
GCAATTGAGATGGAATTGAGGCAGATGGAGGTGGCCCAGGCCAATCGACACATGTCCCTG
CTGACAGCCTTCATGCCTGACAGCTTCCTTCGGCCAGGTGGGGACCATGACTGCGTTCTG
GTGCTGTTGCTCATGCCTCGTCTCATTTGCAAG
gtatggccaatcaatcacatgttccacagaaatctagtgaacttgccatgaaccaggcat
tgaagatgctgagtgaagacaacagagtctctgcccacaaagagtttatggtatagtgga
ggaacacagcaaagtcaccgattaatatatattacaaatggtgtgttttcaaggagagat
EXON 17  161 bp
gtaatcacatcactaccctttccccatgcaagattccccacccaggtaagagctatttct
gctttctctcccatgtgtgtccatgctccccacatagttaagctctgagtactatattcc
tgagtctctgttctccatcctctgctctgaggcccaggttcctggtgctttttcccacag
GCAGAGCTGATCCGGAAGCAGGCCCAGGAGAAGTTTGAACTAAGTGAGAACTGTTCAGAG
CGGCCTGGGCTGCGAGGAGCTGCTGGGGAGCAACTCAGCTTTGCTGCTGGACTGGTGTAC
TCGCTGAGCCTGCTGCAGGCCACGCTACACCGCTATGAGCA
gtaagtgactcctgactccctcaccccagggtgggggtccaggattggccagaactgaga
ttgcctggcagactctagcctcacagtgcccttctctggtctctagtgccctctctcagt
gcagtgtggatgtgtataagaaagtgggcagcctgtaccctgagatgagtgcccatgagc
EXON 18  169 bp
gagcaactcagctttgctgctggactggtgtactcgctgagcctgctgcaggccacgcta
caccgctatgagcagtaagtgactcctgactccctcaccccagggtgggggtccaggatt
ggccagaactgagattgcctggcagactctagcctcacagtgcccttctctggtctctag
TGCCCTCTCTCAGTGCAGTGTGGATGTGTATAAGAAAGTGGGCAGCCTGTACCCTGAGAT
GAGTGCCCATGAGCGCTCCTTGGATTTCCTCATTGAACTGCTGCACAAGGATCAGCTGGA
TGAGACTGTCAATGTGGAGCCTCTCACCAAGGCCATCAAGTACTATCAG
gtgtggggcaagaatttgggcttggggcaggaggcagggaagctttcacttgatgggggc
tcttactaatatattcaaggttgtatgtcccatgcttgctgcttgaggcctggtttgctc
ttagatgaactctccatatgatgcagctgcttgagggctttggattctcttgtacctcca
EXON 19  69 bp
ttgctgcttgaggcctggtttgctcttagatgaactctccatatgatgcagctgcttgag
ggctttggattctcttgtacctccagagacccatgatgaccagggctcaaactacagttt
gggaagaactccccacccgctccagggcctaaaagttgtctgtctgttatctctcctcag
CATCTGTACAGCATCCACCTTGCCGAACAGCCTGAGGACTGTACTATGCAGCTGGCTGAC
CACATTAAG
gtgaagtatctgggccagtgattgagcccccgtggagatcagaaatggagggcatcaggt
caagagatcaggcacccaagaagtgtcacataagactagggcagagttaccaaagccata
tcagggaaactagaggacctacttatgtatgggggtcagcagaggatggggacttcttag
EXON 20  63 bp
agatcaggcacccaagaagtgtcacataagactagggcagagttaccaaagccatatcag
ggaaactagaggacctacttatgtatgggggtcagcagaggatggggacttcttagagat
gttgataaggcagaagggctcctgctgggggctgatgattgcatgcttctatcctcacag
TTCACGCAGAGTGCTCTGGACTGCATGAGTGTGGAGGTAGGACGGCTGCGTGCCTTCTTG
CAG
gtgagaacacatctagatctgtgtgagctcctcttctttcttagtcctcacttccttact
ccgagccttaatgctaacttggttctccatccattttctttttcctgagtagggtgggca
ggaggctacagatattgccctcctgctccgggatctggaaacttcatgcagtgacatccg
EXON 21  150 bp
cacagttcacgcagagtgctctggactgcatgagtgtggaggtaggacggctgcgtgcct
tcttgcaggtgagaacacatctagatctgtgtgagctcctcttctttcttagtcctcact
tccttactccgagccttaatgctaacttggttctccatccattttctttttcctgagtag
GGTGGGCAGGAGGCTACAGATATTGCCCTCCTGCTCCGGGATCTGGAAACTTCATGCAGT
GACATCCGCCAGTTCTGCAAGAAGATCCGAAGGCGAATGCCAGGGACAGATGCTCCTGGG
ATCCCAGCTGCACTGGCCTTTGGACCACAG
gtttaaggctgcaactggggaagggaaggaaactgagtagaaacatgaagggtatagcac
ttgaagatctggatctggttaggggacaaaaatggttttggggtagctggaaactgtggt
gctgaacccagggttgactcctgactctggcctggcacacaggtatctgacacgctccta
EXON 22  162 bp
ctggcctttggaccacaggtttaaggctgcaactggggaagggaaggaaactgagtagaa
acatgaagggtatagcacttgaagatctggatctggttaggggacaaaaatggttttggg
gtagctggaaactgtggtgctgaacccagggttgactcctgactctggcctggcacacag
GTATCTGACACGCTCCTAGACTGCAGGAAACACTTGACGTGGGTCGTGGCTGTGCTGCAG
GAGGTGGCAGCTGCTGCTGCCCAGCTCATTGCCCCACTGGCAGAGAATGAGGGGCTACTT
GTGGCTGCTCTGGAGGAACTGGCTTTCAAAGCAAGCGAGCAG
gtgggcctggatggctgggtagaaggtgtggggagagttagtgaccagtgtggggctttt
acttctgcccttggctcctgcagatctatgggaccccctccagcagcccctatgagtgtc
tgcgccagtcatgcaacatcctcatcagtaccatgaacaagctggccacagccatgcagg
EXON 23  132 bp
ggcagctgctgctgcccagctcattgccccactggcagagaatgaggggctacttgtggc
tgctctggaggaactggctttcaaagcaagcgagcaggtgggcctggatggctgggtaga
aggtgtggggagagttagtgaccagtgtggggcttttacttctgcccttggctcctgcag
ATCTATGGGACCCCCTCCAGCAGCCCCTATGAGTGTCTGCGCCAGTCATGCAACATCCTC
ATCAGTACCATGAACAAGCTGGCCACAGCCATGCAGGAGGGGGAGTATGATGCAGAGCGG
CCCCCCAGCAAG
gtaggtggagatttccttggagaagttgcagaggcctgtaggagtaagacttgcagagct
actgctagttgtgggaggacggggagacaggaggaaggcatctggagagcaccatcctgc
ctagaaggcagggttttccctgtaactggatctctctgtaaggagcacagtgatgatctc
EXON 24  126 bp
aagacttgcagagctactgctagttgtgggaggacggggagacaggaggaaggcatctgg
agagcaccatcctgcctagaaggcagggttttccctgtaactggatctctctgtaaggag
cacagtgatgatctcttctctccaccctcactttctcaccccctaccgaccattccttag
CCTCCACCGGTTGAACTGCGGGCTGCTGCCCTTCGTGCAGAGATCACAGATGCTGAAGGC
CTGGGTTTGAAGCTCGAAGATCGAGAGACAGTTATTAAGGAGTTGAAGAAGTCACTCAAG
ATTAAG
gtgagggtagtgtaggctcaggatctgggggccaggaaattggtaggactcaggaaagca
gtgagtgttggggatcgggaccaagacggcttgggagttaaggggagaagtggggcctgc
aatcaatgggagctgtggtgagccctcagggaacctactatctcatggtctagcccccag
EXON 25  143 bp
aagcagtgagtgttggggatcgggaccaagacggcttgggagttaaggggagaagtgggg
cctgcaatcaatgggagctgtggtgagccctcagggaacctactatctcatggtctagcc
cccagtttccagggactgtggggaggatgtcagggatctagaagttctgtccttgtccag
GGAGAGGAGCTAAGTGAGGCCAATGTGCGGCTGAGCCTCCTGGAGAAGAAGTTGGACAGT
GCTGCCAAGGATGCAGATGAGCGCATCGAGAAAGTCCAGACTCGGCTGGAGGAGACCCAG
GCACTGCTGCGAAAGAAGGAGAA
gtcaggcactttccctggggccttgcttcctctaatcctcccactgctggagctctctgc
ctcctaacccatacccctactcaggttctcttatagtgagactccccattttctttaccc
actgccaaccccattgcatcaccccagcctaagcctgtgctgctctgccctggcttctca
EXON 26  167 bp
tagtgagactccccattttctttacccactgccaaccccattgcatcaccccagcctaag
cctgtgctgctctgccctggcttctcactggcagggctattccaaggacctctcaggact
gaatagtcaaggagtgctttagagaagggacactgccaaagcccagattctctttcacag
AGAGTTTGAGGAGACAATGGATGCACTCCAGGCTGACATCGACCAGCTGGAGGCAGAGAA
GGCAGAACTAAAGCAGCGTCTGAACAGCCAGTCCAAACGCACGATTGAGGGACTCCGGGG
CCCTCCTCCTTCAGGCATTGCTACTCTGGTCTCTGGCATTGCTGGTG
gtgagtactgtggaataggcagcactagcacagaggagattgtcttctctcctgtccttg
gcctcattttgacctctgccccaccccccttacccccgggtattcagccaggaacatgct
tacacagtttcactctgtgccagttttcaccaagttttcccttccgctgaagatgtgtgc
EXON 27  15 bp
ttatctgctcgtccccaaagataggtggcagagagtcttgttagagaaagtatgatgatt
aggaaaagggttttcctgcaggttgtgtccaggattcctctggtgtgtccccgtaacccc
caaatcacctaactcctctctcctcttttcctgctcccccatgggctatcccgagcacag
AAGAACAGCAGCGAG
gtagagacccactctggccgggggttaccaggctggtgggagttggagctaagggagcag
ggtggagggggaagccaggactggagatgggtgatggggggatgaggaaaggggaagagt
aggaatggagcccaattttcaaccctttccacttggggctgatgagattttttatggtcc
EXON 28  134 bp
acccactctggccgggggttaccaggctggtgggagttggagctaagggagcagggtgga
gggggaagccaggactggagatgggtgatggggggatgaggaaaggggaagagtaggaat
ggagcccaattttcaaccctttccacttggggctgatgagattttttatggtccccacag
GAGCCATCCCTGGGCAGGCTCCAGGGTCTGTGCCAGGCCCAGGGCTGGTGAAGGACTCAC
CACTGCTGCTTCAGCAGATCTCTGCCATGAGGCTGCACATCTCCCAGCTCCAGCATGAGA
ACAGCATCCTCAAG
gtgagggagccacggggaggactgggatgggagatggagcatatttgccccattgatgat
agatgacaggggcctcctagcacctcttaccactatccttcttttttcatccacagggag
cccagatgaaggcatccttggcatccctgccccctctgcatgttgcaaagctatcccatg
EXON 29  184 bp
tcagcagatctctgccatgaggctgcacatctcccagctccagcatgagaacagcatcct
caaggtgagggagccacggggaggactgggatgggagatggagcatatttgccccattga
tgatagatgacaggggcctcctagcacctcttaccactatccttcttttttcatccacag
GGAGCCCAGATGAAGGCATCCTTGGCATCCCTGCCCCCTCTGCATGTTGCAAAGCTATCC
CATGAGGGCCCTGGCAGTGAGTTACCAGCTGGAGCGCTGTATCGTAAGACCAGCCAGCTG
CTGGAGACATTGAATCAATTGAGCACACACACGCACGTAGTAGACATCACTCGCACCAGC
CCTG
gtatgtacctgccaacccccaagatgaataaaactgccccctccacttggcccagggatt
tagcccctgctcaggtggttcccccaccacagaagctcttcccagcagtgttctttggct
tcactgttcagtttgtttgattcacccactctctctcaagtacttgttctgttagagagt
EXON 30  80 bp
caccacagaagctcttcccagcagtgttctttggcttcactgttcagtttgtttgattca
cccactctctctcaagtacttgttctgttagagagtcttatacctgcacccctaaccctt
aatccagtagaactgcctgcctgcgccttggtgggcctcaccagctttctctccccacag
CTGCCAAGAGCCCGTCGGCCCAACTTATGGAGCAAGTGGCTCAGCTTAAGTCCCTGAGTG
ACACCGTCGAGAAGCTCAAG
gtcagctcagtttgccaggcagagctcacttcacagcataaactggtggagccaggcact
tgtggagttcctctgagcccagccctgtgctagacagcaattggggaggagatggaaggg
aaggcagggttcttgccttggaagctcactgtctcagtgcaaacagaagacagattctca
EXON 31  90 bp
tgcaaagtaaggaggagtgctggtgtggggatggggttggagatgagagcaaaagtatgt
tgatatagaggactaagtccctgcccccctggtattagtgtctctgtgaaaccacgtggt
cttgtgctagcctgtgggggtcccataaatgaacccttgtcttcctctccccttccctag
GATGAGGTCCTCAAGGAGACAGTATCTCAGCGCCCTGGAGCCACAGTACCCACTGACTTT
GCCACCTTCCCTTCATCAGCCTTCCTCAGG
gtgagggggagcatggggtggaggatgggacagtgtggagagctcaggcgggcccccctc
tcctccagaattggaggaggcctttggagtctcaggtctaacaactgcataccttgggtt
atctggccaaattttacttacaagtaactcagaagtgcttacagtgctttgaaattccaa
EXON 32  482 bp
tcccttgtcagattatgtatccccattcttatttgaaaaatgtggtcacaatagcccagg
atctcagaagccctagtcacccaggagctgccttggtctcagtgctcagggaccccttca
gtggcccacagctcaagtgagcccctgacctggagtctttttctcctcatcaaccaccag
GCCAAGGAGGAGCAGCAGGATGACACAGTCTACATGGGCAAAGTGACCTTCTCATGTGCG
GCTGGTTTTGGACAGCGACACCGGCTGGTGCTGACCCAGGAGCAGCTGCACCAGCTTCAC
AGTCGCCTCATCTCCTAAGCACTCCTTTCCCCTGCTGTCCCCTTCGACCCTCAGCCCTCT
GGTGCCGCTCTGCCCGATGCACAGCCACCTCAGCCAGCCCCCAGGTAGAAACGTGGGTTA
AGCTCTTCCTGCCCCGTTCAGCTTCACTCCCACCCTTTCAGCGTCCTGCCCCTTCACCTT
GACCCGGGTTCCCCCACTCCCATTCCCTGGCCTCTGCCATAATTTGTTGTTCAACTGCTC
CCTCCTTCCTGAGGGGCCTCAGGGCTTGTGGGGGGTAGGCTGAGACCCCACCACCAAAGG
TTAAGTGAGGTCCCCTTGATTGAGGACTTCACCCCTTGATTAAAGCAACTTCTGCTTCAG
TG
cttcctgtgtggtgttgagagtgggacttgggccattaagctcacagcaggagtggagga
gaagcgatgctgaggaagctttggctgtatcaaatttgaggtctcctcttcgtagtgacc
agaagaatgctgtttctaaaattcatgtgcagtaagttactctaaccaaggaggaaaggg