Gene CREB1 Variant 2
DNA : 68.90 KbNT_005403
mRNA : 2965 bp NM_004379
CDS : 984 bp NP_004370
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  173 bp
tctccccgcggaaccccttctcgtcgcccgaagaaacccgaaggtcttcggcaagttccg
tccccagcgcgggggcggggccgctcgagctgctccgggcctagctcggctgtttccgtg
cgcggccgctgcgcactcggcactgggcggcgctggctggctccctggctgcggctcctc
AGTCGGCGGCGGCTGCTGCTGCCTGTGGCCCGGGCGGCTGGGAGAAGCGGAGTGTTGGTG
AGTGACGCGGCGGAGGTGTAGTTTGACGCGGTGTGTTACGTGGGGGAGAGAATAAAACTC
CAGCGAGATCCGGGCCGTGAACGAAAGCAGTGACGGAGGAGCTTGTACCACCG
gtaagaggagcaggaggaggaggcaggagccagagagagccggggggacggaggggggac
ggggaggcgccggacacccgcgcttggggccttcccctcgcaggaggggccgcggtaaag
atggagcctccgcccgagccccacaacatcgccgccgctcgcagcgaacaaagaataatg
EXON 2  122 bp
ctcagcaaatttgaataagtttgatggtaattcagctacattatattttagctagatttc
tgagttcatttggtaacctaaccaccacatatatacctatttataacttgaaatttgcct
ttaaagtcacgaaagcacaaagcactgtggtgcttgtaacactcttccatattattatag
GTAACTAAATGACCATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAA
CAGAAGCTGAAAACCAACAAATGACAGTTCAAGCCCAGCCACAGATTGCCACATTAGCCC
AG
gtataaaatacatggagagattccagtttgtgtctcttcctagaggaatacgtttccaag
agaatttagttgttattacatagatatacatagaatgagcagagatactcttacaatatc
aaaattcctatttacttagtattagagtatatttagaaatgatagtattaattcaataac
EXON 3  147 bp
gtgttttttatagtgttttttcttaaagaatattaaatttagtcattactttcatatcag
tgaaatacatatctagcaaaaaggtcacgtttttgcttctaaaaagttatttcatattga
acatgagtactgccaaagagtgtctgggatgataattcttttctgtgttcaacaccatag
GTATCTATGCCAGCAGCTCATGCAACATCATCTGCTCCCACCGTAACTCTAGTACAGCTG
CCCAATGGGCAGACAGTTCAAGTCCATGGAGTCATTCAGGCGGCCCAGCCATCAGTTATT
CAGTCTCCACAAGTCCAAACAGTTCAG
gtatgtgtataaaaagttctgcatctattttaataacttttgtttatagccatatctctc
tcctttcactagttatgaaaataaggacacatctagttcagtttattttattcacagtat
aggaatatgctgcatctgtatagtcaccttatgtataggaacatatatacagaagaacaa
EXON 4  101 bp
gtagtttatagggtaagtaaagggaaggggaaagtgattggtgtggttgtctcccataag
aactgatttttttctactgaagcatgtataaagtttatatatgactttttatatttgttt
aataaaaattttacaggaactaaatttgattatcaatatgaagtttttctttaatttcag
ATTTCAACTATTGCAGAAAGTGAAGATTCACAGGAGTCAGTGGATAGTGTAACTGATTCC
CAAAAGCGAAGGGAAATTCTTTCAAGGAGGCCTTCCTACAG
gtatggaatttaatagttagaatcaaagatgtggaggaagtcttaggtagttgcagataa
agagatgtcagaagaccagttagttgttcacgtcagttccttatagattacttttcttca
tcttgagttatttgtctcaaataaagtggaagcttatcctacagaataagaagagcactt
EXON 5  143 bp
gccactgcactccagcctggcgacagagcaagactccatctcaaaaaaaaaaaaaaaaaa
aaaaccttctgtcctaagcactagcagctttctgtgagttttctcatctttaactatatt
tgtatttagccagtaaattgtacttatatttttaattattctagttttctaattttgtag
GAAAATTTTGAATGACTTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAGAA
GTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTA
CCAAACTAGCAGTGGACAGTATA
gtgagtaatagacaatttctgtttctattgtgaggagaaaaaagtgaggagaaaaagcta
atagttgcattctcttcagagaaaccaatacaagtgccaagtcttctcagttttgctgcc
attattatatttcctttactcttcactatgcaaaggtctgtaatggtagtattttctttt
EXON 6  183 bp
tagaagttgaatatgggtttcctgaggagcaagttacttgaatatattagacccttcttg
gtgatgttatttgctgtaacttctcctagattattttacaaattattctacattggatgt
aatgttttaaaagtcttatatggtattaaacttgtaacaataaaatccattggcttttag
TTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGGGTACAGG
GCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACCATTCTAC
AGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTTGTTGTTC
AAG
gtaagggaattcagaattcacaggtgtggtaaattcttcaaaatactaaaattttataaa
ctcacagaaaaagtaagtatcatattgcaaaccaccattcaaatgtagttaacatttctt
caatattgatagtatttttcatgaactcttccattattccaattggaccaaaatgtcatg
EXON 7  151 bp
ggaattatttcttagtagtggcgcgaagagtgctgattctttcaacgctttagccagaat
catcttttcttttttgtttcccttttagtccaaaatacatgcttagattgatgattgata
cacataattgaatcaagttgcaatgtttctgtcttacaccatgctcactgtttttttcag
CTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGCACTATTGCCC
CTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAAGAAGCAGCAC
GAAAGAGAGAGGTCCGTCTAATGAAGAACAG
gtacaaatactgcatttacttagattgttatgtgttaagtgtgtcttcacattctgctgg
atgtgtatctttacatctactggtaataggatctttgcattgaattttttttttccagca
gaattaatggatcttgctaaattttctttatttaataagctgcacttataagatagctgt
EXON 8  1945 bp
gattaaaattttaatataaggtaatttccaagtaattctgtatatcttttccaatgctta
atatatactaaaatgttggttgctgtgagctatttctttaaaaaagaaaaaaaaaaggta
atccaaaataaatatgtggaaatcatttgcataatttttcccgtcctcttttgcttgtag
GGAAGCAGCTCGAGAGTGTCGTAGAAAGAAGAAAGAATATGTGAAATGTTTAGAAAACAG
AGTGGCAGTGCTTGAAAATCAAAACAAGACATTGATTGAGGAGCTAAAAGCACTTAAGGA
CCTTTACTGCCACAAATCAGATTAATTTGGGATTTAAATTTTCACCTGTTAAGGTGGAAA
ATGGACTGGCTTGGCCACAACCTGAAAGACAAAATAAACATTTTATTTTCTAAACATTTC
TTTTTTTCTATGCGCAAAACTGCCTGAAAGCAACTACAGAATTTCATTCATTTGTGCTTT
TGCATTAAACTGTGAATGTTCCAACACCTGCCTCCACTTCTCCCCTCAAGAAATTTTCAA
CGCCAGGAATCATGAAGAGACTTCTGCTTTTCAACCCCCACCCTCCTCAAGAAGTAATAA
TTTGTTTACTTGTAAATTGATGGGAGAAATGAGGAAAAGAAAATCTTTTTAAAAATGATT
TCAAGGTTTGTGCTGAGCTCCTTGATTGCCTTAGGGACAGAATTACCCCAGCCTCTTGAG
CTGAAGTAATGTGTGGGCCGCATGCATAAAGTAAGTAAGGTGCAATGAAGAAGTGTTGAT
TGCCAAATTGACATGTTGTCACATTCTCATTGTGAATTATGTAAAGTTGTTAAGAGACAT
ACCCTCTAAAAAAGAACTTTAGCATGGTATTGAAGGAATTAGAAATGAATTTGGAGTGCT
TTTTATGTATGTTGTCTTCTTCAATACTGAAAATTTGTCCTTGGTTCTTAAAAGCATTCT
GTACTAATACAGCTCTTCCATAGGGCAGTTGTTGCTTCTTAATTCAGTTCTGTATGTGTT
CAACATTTTTGAATACATTAAAAGAAGTAACCAACTGAACGACAAAGCATGGTATTTGAA
TTTTAAATTAAAGCAAAGTAAATAAAAGTACAAAGCATATTTTAGTTAGTACTAAATTCT
TAGTAAAATGCTGATCAGTAAACCAATCCCTTGAGTTATATAACAAGATTTTTAAATAAA
TGTTATTGTCCTCACCTTCAAAAATATTTATATTGTCACTCATTTACGTAAAAAGATATT
TCTAATTTACTGTTGCCCATTGCACTTACATACCACCACCAAGAAAGCCTTCAAGATGTC
AAATAAAGCAAAGTGATATATATTTGTTTATGAAATGTTACATGTAGAAAAATACTGATT
TTAAATATTTTCCATATTAACAATTTAACAGAGAATCTCTAGTGAATTTTTTAAATGAAA
GAAGTTGTAAGGATATAAAAAGTACAGTGTTAGATGTGCACAAGGAAAGTTATTTTCAGA
CATATTTGAATGACTGCTGTACTGCAATATTTGGATTGTCATTCTTACAAAACATTTTTT
TGTTCTCTTGTAAAAAGAGTAGTTATTAGTTCTGCTTTAGCTTTCCAATATGCTGTATAG
CCTTTGTCATTTTATAATTTTAATTCCTGATTAAAACAGTCTGTATTTGTGTATATCATA
CATTGTTTTCAATACCACTTTTAATTGTTACTCATTTTATTCACTAAGCTCGATAAATCT
AACAGTTACTCTTAAAAAAAAAAAAAAAAGACTAAGGTGGATTTTAAAAATTGGAAACTG
ACATAATGTTAGGTTATAATTTCTCATTTGGAGCCGGGCGCAGTGGCTCACGCCTGTAAT
CCCAGCACTTTGGGAGGCCAAGGTGGGTGGATCACCTGTGGTCAAGAGTTCAAGACCAGC
CTGGCCATCATGGTGAAACCCCATCTCTACTAAAAATACAAAAATTAGCCAGGCGTGGTG
GCTGGCGCCTGTAATCCCAGCTACTCAGGAGGTTGAGGCAGCAGAATTGCTTGAACCCAG
GAGGCAGAGGGTTGCAGTGAGCCGAGATAGCACCATTGCACTCCAGCCTGGGCGACTCCA
TCTCAAAAAATAAAAATAAAAAAAA
tgtctcatttgggaaggaaattccttttaaaaaagagttgagacacttagaaaactaatg
ttttatatttagtcaagagttatttaagaaagtcaagcttgtttaacaacaaaatatgaa
gatttaagtgttaattgctggatccattttaaaataagattttaattaacatttgtaaat