Gene COL5A2 Variant 1
DNA : 147.25 KbNT_005403
mRNA : 6190 bp NM_000393
CDS : 4490 bp NP_000384
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  255 bp
atgaaatagggaaagttcaggcacagagacgcgtgttctgatttggttgtttaccatcaa
tcagaccgttgcttggcagacactggatggttatgagcctgaacaagctgaaaaggggca
ggaaaagaagtggaggcagcattcttcctatttaaagctgcatcgcttgaaaaaagtttt
CGCAGACTGTGCTGGAGCTGGTGCTGAAAAAGGGGGTTTGCAGAGGCTGCCCTGGGGCTG
GTGCTGAAAGAAGAGCCCACAGCTGACTTCATGGTGCTACAATAACCTCAGAATCTACTT
TTCACTCTCAGGAGAACCCACATGTCTAATATTTAGACATGATGGCAAACTGGGCGGAAG
CAAGACCTCTCCTCATTCTTATTGTTTTATTAGGGCAATTTGTCTCAATAAAAGCCCAGG
AAGAAGACGAGGATG
gtgagtttgccatttgctttgcttgtagtgtttattgcacggtttgggaaataggtggaa
tgttaagcctcaggaagagcgtgaagaggaggttctggtttgaagtttgagaagggggct
gacggatttgcacctggaaaacgacttgaaagacaattgggatgtttgtaaatccggagc
EXON 2  225 bp
tatttcatggtgaattacatattattttgttatgaaatgaaatcagttcatctgtgtttg
gctccttggaaggttacttcttagtccagaattttttagaatccacaagatggctcacct
tttattttctcaattctataatttcagattactaacctcttctttcttttcttattttag
AAGGATATGGTGAAGAAATAGCCTGCACTCAGAATGGCCAGATGTACTTAAACAGGGACA
TTTGGAAACCTGCCCCTTGTCAGATCTGTGTCTGTGACAATGGAGCCATTCTCTGTGACA
AGATAGAATGCCAGGATGTGCTGGACTGTGCCGACCCTGTAACGCCCCCTGGGGAATGCT
GTCCTGTCTGTTCACAAACACCTGGAGGTGGCAATACCAATTTTG
gtaagaatgtttagggccaactcataattgatccagttactcacctttatagttgcagtg
tttttcactttcagcattcagcaactcaagagaataattaagcagcttttttggtggctt
ttggggttaatgattaatgattttgctcactcacttcatctaaagttagatagaagcaga
EXON 3  14 bp
ttttgccttttatggaagtattgatccaaaaccttttgaattctgcttactgctgatagt
gtaatcactatcactgtaattctgactccagaagaaatctattattgaaagtaaatattt
agcagattctcaataattgtttcctcataaaataacacatttactcttttctttttacag
GTAGAGGAAGAAAG
gtaagtgttactttgcatattttctttttcataagcagacttatatccaatactatccac
acagaactgtgctctgaaacgtttgaaagcttttgaaaagtacaaagtaccatacaaata
cattgtgacaagtatataagcacagttcagctactgtgtttccaaaggacagatgcctct
EXON 4  33 bp
tttaatgagtaatatctgactaaatatcctaaaaattgttaactttctttttgtagtttt
ttgcatttcttacatagaaattccctgtgtttacatggcatattctagggtgacatgttt
ttgcccagcaagccattatattgtgctaattgaatttttgaattgtttttaatgtcacag
GGACAAAAGGGAGAACCAGGATTAGTGCCTGTT
gtaagtatatgtataatcattgtttccttgtaccttaaataaacttagcttatagtataa
ttgtatattattgcttatgtacatactttcaaaaataaattagttattttaaaaacaagt
ttttagtataacacaagcaaaccagaacagattagttatttaatacaatatttgatattc
EXON 5  33 bp
ttagttaaaactagataatatcttaaatcttaaggagaggaggaaatggtcatcaattga
caacatccatttgttaaaaaaattactgtggtttttgttgttattcttatttgttactat
tgacctctctgaatatctgcagaaactttacctttacaaattttcttgtttattgtttag
GTAACAGGCATACGTGGTCGTCCAGGACCGGCA
gtaagtagtttctcccaatattcttggtactcttgtattccttgagatactgaaaatctt
tacagatattatatccatgagaagataaaagaattaaacaatgatacttggtctcttaaa
acattttgtcttaaaccatcttcaagttagacattgctttgcagcaatgaatggtagata
EXON 6  54 bp
acaacgcttctaagcgtacagaacttttatatgcacatggctttattctctatagtcttc
aactgaactgaattaagtgtggtatttctgttttccaattttcttttatcaagtagactt
ttaaaaattcaataagaaagtatacatttttgcatgcataatcatcattttctgttttag
GGACCTCCAGGATCACAGGGACCAAGAGGAGAGCGAGGGCCAAAAGGAAGACCT
gtaagttgacaggagggctccttgtggggaacgtacagccagtcagtttacactgtgttc
tctgaatgcagcaagaagctgggagcactattcctctttcacctccattaaattttacaa
aaatacaataataattgtatattatcttattagataacacaaatgatatttccttgtccc
EXON 7  111 bp
agttcagacctatgctgaaatcagtagtgacatggctgatgaaattactctaagtggcta
gattgccatgtatttttaaaataataaacactcccttgccattaagaagtctgtgccttt
agctttctactaagtgtatatttggcagtgggttctaattttaactggcttgttttccag
GGCCCTCGTGGACCTCAGGGAATTGATGGAGAACCAGGTGTTCCTGGTCAACCTGGTGCT
CCAGGACCTCCTGGACATCCGTCCCACCCAGGACCCGATGGCTTGAGCAGG
gtgagttgtgtgcattgtttgatgtcacgtacaggtcatgttttaaattattgatatatt
gttaggattttaaattgtgtctgttcagatattgacacttgactgtaagagcagttaaat
aaggtcaacactgctatggacagtagaactaataaacccacagggaattgttggaaaaat
EXON 8  78 bp
aaaagcacaaacaatcaaagcaacttaagtctttttccaggctttaaagtcaagcactta
gaatgattctcagaagagtcattctataagaattctagagagtgtacatttatccatatg
aaaaggacgttgatgtatgtcttttactgtagaaataatgtcaacatatcgcttttacag
CCGTTTTCAGCTCAAATGGCTGGGTTGGATGAAAAATCTGGACTTGGGAGTCAAGTAGGA
CTAATGCCTGGCTCTGTG
gtaagcataaattttactgatcattgaagtacttcagtgaaaaaaattattttaaaaaga
gaatcttgagttaactagtcaaagaataacatgcatcttcttaaacacagtcgtacattc
attcattcattcatttaattaacttatttactctactgtatgccagttaaaagcccagtg
EXON 9  45 bp
gtccaagctttaatctccttgaatttagctgccttccaaatgagtacagatggagaatgt
catcatccccctttgtcaaaacttcacttttccagattctagagatgattcaacattttt
gaaatatttgacctaattgtcatgagtactttgcaacgtttctcctcatttgtttttaag
GGTCCTGTTGGCCCAAGGGGACCACAGGGTTTACAAGGACAGCAA
gtaagtctctttataattaattacatgctgtaagaaaaacatacacacacacatatatta
cataaggtctctgtgacatgactgcttttggctggttttaaaattttatattgtaatgct
cacttcaaacaggatatattaaatagtttttatttagaaatatatgccacatgtctttgc
EXON 10  54 bp
ttattctgattttacacattaggaaacagttacagacagattaagtaacttgcccaaagt
cacacagctggaagatggcagagccaactgtctaaacaattacactgtatattgacagag
tacagggtttaatattctatttttccttggtttgtatatatactttgttttcaactgtag
GGTGGTGCAGGACCTACAGGACCTCCTGGTGAACCTGGTGATCCTGGACCAATG
gtaaatgtcaagtaagcatgtagacccagttacatttgggtccaccattataatgatgtc
aaatattgagttatttatcttcccaggtcctccctaatgtaggaagaaataacaatccag
tttgggagtcctgttctatgaactgttcttaagctatatgtttctcatagcagaatattt
EXON 11  54 bp
gatgcaacataaaattcaaaactttaataaaactattttctctgtctcaacaatatttat
cattttcatttgtttcaataatagtttgacatttcatttgtctcaataatgttttgaatt
gtattactggcaagtaaaggtaaatattctttttttccttttgttttgttctgttattag
GGTCCGATTGGTTCACGTGGACCAGAGGGCCCTCCTGGTAAACCTGGGGAAGAT
gtaagctacctttcctcattttccattcaggttttgaagaggcgaaggggttaaaatgtt
aacaagaatgttctgtattaatttccattacatttccccacccttttagcttgcattaaa
ttcaatgtaaacaggagcactcagaatggaattttacaaatatctaaaagggctcttaat
EXON 12  54 bp
actatcaggaatataaggaatagagcctatttttactttattttttgcactgtttagaga
attgtacattagctttctaaagaagactgttttattagtaatttatttatcatttagttt
cagagaagaaccttttaatcacttttgccttcccaatctcctacatttttttccataaag
GGTGAACCTGGCAGAAATGGAAATCCTGGTGAAGTGGGATTTGCAGGATCTCCG
gtaagtttatactcaacataaaggcaaactttgaaaaataaagaacattgaattaaatca
caattctctgtatgcacatgtatcaggcactaagtaaatggagacaaacagcattgtttg
tttccgtaaaaatgtaaaatgtcacaggacgttttgccagagtgattgttaactccagtt
EXON 13  54 bp
tgctaattttgatcacccagatatattttgacagataaaagtatactgcttttttttgtt
cttcttaatatgttgctggaaaactgtgtactagctattttttgggaaaaaatgatatat
taaggaattttgcatccttattaatgactgtaaaatgccctatctatgttttcctcccag
GGAGCTCGTGGATTTCCTGGGGCTCCTGGTCTTCCAGGTCTGAAGGGTCACCGA
gtaagttcaatctattgtaatcctctcagatactgtggtttagtgaacaggctctgggga
gatttaccttcaaaatctttacaagtcaatttgtcaattgtccttaactgtctatggttg
cagtattcatctgtggttactgaaatcacaattttttaatacatttcctttgagtttaat
EXON 14  54 bp
tctaattttccttgaataagctttcagaaaagtttgagaatttgaaagtattttgagcaa
caactttaaatttgatattcatttttataaggcaatttctgcaagcttatttttggttct
tatgcctttgaggattgaaaaaaacaggatacaaatacaaatttacatttttattctcag
GGACACAAAGGTCTTGAAGGCCCTAAAGGTGAAGTTGGAGCACCTGGTTCCAAG
gtaatcttataattatctcactgtaacctcactttggcatcttagttttgcttcaaatgt
ttacacatttttcagaaccaccttaattcagcaggagagagggctacaaacaaatggtta
ggtaaataaacataatttttcaaagatgagtggcaatggctttaccatgacatgacttga
EXON 15  45 bp
aactacactactattgcattttgagaagaggtaataaaacaacattctgagatcctatat
caaaagtacatctttcatatgtcctctttgaaaatatgcttttaaaattacacacacaga
acaaagtgatgtatcggttgtaggcttctcatactgtaatgtattctcatttttttttag
GGTGAAGCTGGCCCCACTGGTCCAATGGGTGCCATGGGTCCTCTG
gtatgtgctcgttttcttgtttcttaaatttctaaggttatatttccttgccttttagat
tacaacaagagaatttttaaatgaaaaataaaaataaatggacaacatatgttggctagt
aaaataatcttgattaccagctgatagacaagcacaggagagttgagcccttctaacaga
EXON 16  54 bp
gaggtgataggttatttatctccacatggggatagtttttcaaacccaacattgcccctg
gaaatactactgcttggtggccaattatcttgaatctcaattggattgagtggggtagtc
agactactctacatttcaaattaggtgcttcaagagacatttcttctctatcgtctatag
GGTCCGAGGGGAATGCCAGGAGAGAGAGGGAGACTTGGGCCACAGGGTGCTCCT
gtaagtatatctgcttttacttatactgctgagatgtgtatttcaattcattttcagatt
tggtttactgaacttgccttttaaatgaaagtaatagtactggtcacctttttttttttt
ctttttcttttggaataaagtcaggtttacagaaaagttgaaaagaaagtacagagaatt
EXON 17  45 bp
ctaccatatcagcttgtgtaaatgtatttatattgctattaactgagtgagggttattgt
cagttaactttaatatttattcttcaatttgcaatatggaaattttttataaggcaaata
agagaaaatatagtctaaaatgtaatcttatcctgtcttgtctctttttctcttaattag
GGACAACGAGGTGCACATGGTATGCCTGGAAAACCTGGACCAATG
gtgagttatattattttcatattaattcattaatttattcatgcattcttccatttgtac
attcaaaaacatttacagagcactcaccacatgccagacacttggaataaaaagttgatg
gacacatagtacttcttcaaaactgttctattaaggaagagagagatattaatattgttg
EXON 18  54 bp
tactttagattgatgttgaaggtacttataatgaaattagcctattatctttgtaatttt
aaagtgaaaggcaggttattcttatgtgtctaatacaaaatgacgccaaactctaaaaaa
tgacctaattagatactaattgaatacatgtctgattacttttctggtttcttttaatag
GGTCCTCTTGGGATACCAGGCTCTTCTGGTTTTCCAGGAAATCCTGGAATGAAG
gtaagatgttaatgttaatatacagtatttaacgctacatgattacatgagtcccaaagt
gaagaatgacatttaattaattgaaaagtgtgaaagttacttttaactaaggaaagagcc
tagagtatgctcatttttcattattacatggaaaaagatacattaaaaaataaaattaac
EXON 19  99 bp
gaaggaagtgggaaagtgagtgcgctccttaagcttggttgggcacgcatctcttgtaat
cctctttggcctctttcagtatttgggtttcaaatgtaaaattccaaataagcggtcaac
tttgtacaatgccactctcgtatttttcttaaattaacatttccctttgcacccttttag
GGAGAAGCAGGTCCTACAGGGGCGCGAGGCCCTGAAGGTCCTCAGGGGCAGAGAGGTGAA
ACTGGGCCCCCAGGTCCAGTTGGCTCTCCAGGTCTTCCT
gtaagtttctagcatatttaagaaccagcccagaaagctggacatttcttgtaacatcag
aacaaattcaacctatttttttaattgatacataatatttgtacatatttagggggtacc
tgtaatgttctgttatatgcctaagatgtgtaataatcaagtcagggtatttaagatatc
EXON 20  45 bp
tttacctattttatgtaaaggagaagtagtcaaaaaagtaatttttatgatataatggtg
gttgatttttaaaaaatgcttctacttcctttttgaagatggctggacatctgtatacta
gcacatttgtatctatatattgcttaatatttcattacatacttttaatgtaccttttag
GGTGCAATAGGAACTGATGGTACTCCTGGTGCCAAAGGCCCAACG
gtgagtactgcatttatggcatgtgaagctcaaatgggcatgattctttagacattggcc
ccagactgctacctgtgtctctacttaccacatcactcttgctgtttaatagggctctcc
aggtacctctggtcctcctggctcagcagggcctcctggatctccaggacctcagggtag
EXON 21  99 bp
catacttttaatgtaccttttagggtgcaataggaactgatggtactcctggtgccaaag
gcccaacggtgagtactgcatttatggcatgtgaagctcaaatgggcatgattctttaga
cattggccccagactgctacctgtgtctctacttaccacatcactcttgctgtttaatag
GGCTCTCCAGGTACCTCTGGTCCTCCTGGCTCAGCAGGGCCTCCTGGATCTCCAGGACCT
CAGGGTAGCACTGGTCCTCAGGGAATTCGAGGCCAACCG
gtaatgacctttgaaagaactatcatcctttagtgtaatctaactacgagggccaagagt
aataacatgtcatgtgatgcaatgaaacatagataacgtgacttatccaaatgtgggaag
atgggagtctttgtgaagtgaaagctaaatgttgaggtacaacttagatgtttaaattct
EXON 22  44 bp
acatattaacatattcacatgcattcatttaaaaatgattatattatactactgatgcaa
aaccgactcagctggagagaatttttaaagcctatttattgtaactaatttgagcagatt
ggactagctaaatgtcctggttcttacaaatatcaatatatttttttcagggtgatccag
GAGTTCCAGGTTTCAAAGGAGAAGCTGGCCCAAAAGGGGAACCA
gtaaggtttcattgttttaatgataagtagaacatagtattgtctggaagtgtacagctc
aaaatgctcaagggtttaaaataataatgagaattataatagcttgagatgaaaatatct
cattgttccatatactttaaaatttgtgactgacttcgttaaattaggcttccaactata
EXON 23  108 bp
gtacagctcaaaatgctcaagggtttaaaataataatgagaattataatagcttgagatg
aaaatatctcattgttccatatactttaaaatttgtgactgacttcgttaaattaggctt
ccaactataattcactggttggatgggtctttctggtaactgtccttctgtttttaacag
GGGCCACATGGTATTCAGGGTCCGATAGGCCCACCCGGTGAAGAAGGCAAAAGAGGTCCC
AGAGGTGACCCAGGAACAGTTGGTCCTCCAGGGCCAGTGGGAGAAAGG
gtaaatttaaataatacaacacattcttacagttgtgagggaattatgtgtgtaagtctg
agaacagtaaggaaaactagaacagttaagagaaatgcttgcaggttccctgcacagttc
agtacagttatgtgcaaatagaaagagccaactgactaatcattattcatacattcaact
EXON 24  54 bp
atattcttcaaaattttaaagtttttccatcgagtcagatttttctcatgcatatctata
gccatgttggcttgatgatggctcctaaaactttatagtgctaaaaataaaaatcaccta
ttcattacatattgcaaaaatatcaacaacaattaagaatcacattttggtcatttgtag
GGTGCTCCTGGCAATCGTGGTTTTCCAGGCTCTGATGGTTTACCTGGGCCAAAG
gtgaggttgccctgtcaatgttgatacttacgtggggggtgctccagaagatgccatttt
tcagcacggtgatctagctatggcctgcatgggctcagatccagaaaggagatggataca
aataccaggcctaaccccaatcctctcttgtgtaattcctgtattaagaggcataggggg
EXON 25  99 bp
aggcataggggggaaggatgctagttggcggaatgtggtgacaaaattttatacgttata
tcagtgccttgatttgtatgttatattagtgccttgatttgtaaaacgataattttactt
ctgcttgcttttgtttttctatactctttttcttcatgcatctgctttgcctcggtacag
GGTGCTCAAGGAGAACGGGGTCCTGTAGGTTCTTCAGGACCCAAAGGAAGCCAGGGGGAT
CCAGGACGTCCAGGGGAACCTGGGCTTCCAGGTGCTCGG
gtaagaatatagcaagtgtttgctacatcaaaggggagaagtgctcctgagcatgcattg
gtcgggtttttgtttgtttttaaatttagtttgtttttacagtttagaacatttctttgt
ttttatggttttgatccaattcattattttaaaaaatactggtttgttatttttatcata
EXON 26  54 bp
aaagtaattttggcagagaaattctgaaaaattttaacaatacatcacttaaaaatttat
ttgatttacagaaatgtcattctattcagttgacaaaaatgcaacactatttttactctt
aagaatctttacttcaactgcatatcagcaacaaactgacagttggttttttattttcag
GGTTTGACAGGAAATCCTGGTGTTCAAGGTCCTGAAGGAAAACTTGGACCTTTG
gtaagtaatttaaacagaagtccacaaccactaatatttttcaacagacatgcaacttaa
atgatatttatttaggttaatgtttttgattatatggatgctggtcatattgacatattt
gtaccaacttctggaagcatattcttaggatctattttcaagttgacaaaaatgtagatc
EXON 27  99 bp
tacttaaaatacttcagtgttttttaaaaaacccattcaactgtcctgattctttaacat
gaaaatgcaagataatttaaaatttatgtaacatgatagtaagcaaaggtgacactttgg
gtgatgctatgtttagaaacaacttacatgaaacttacatggctcctgtcaattctatag
GGTGCGCCAGGGGAAGATGGCCGTCCAGGTCCTCCAGGCTCCATAGGAATCAGAGGGCAG
CCCGGGAGCATGGGCCTTCCAGGCCCCAAAGGTAGCAGT
gtgagtacagtgtataatatgttggccacctcatcatgatcctcatttggaggaggtatg
tttttgacaaattgaaggaattatacaaaagtttcatttattctttagggtgaccctggg
aaacctggagaagcaggaaatgctggagttcctgggcagagggtaaatatacattttctg
EXON 28  54 bp
ggtcctccaggctccataggaatcagagggcagcccgggagcatgggccttccaggcccc
aaaggtagcagtgtgagtacagtgtataatatgttggccacctcatcatgatcctcattt
ggaggaggtatgtttttgacaaattgaaggaattatacaaaagtttcatttattctttag
GGTGACCCTGGGAAACCTGGAGAAGCAGGAAATGCTGGAGTTCCTGGGCAGAGG
gtaaatatacattttctgctaaagaaaaataatgtaggtactatttaaattatcatagac
tcacctcacaaatatctgtgtgtgatactagggagctcctggaaaagatggtgaagttgg
tccttctggtcctgtgggcccgccggtatgtgatttttgtgtgtgtgtgtgtgagaatat
EXON 29  42 bp
gaaggaattatacaaaagtttcatttattctttagggtgaccctgggaaacctggagaag
caggaaatgctggagttcctgggcagagggtaaatatacattttctgctaaagaaaaata
atgtaggtactatttaaattatcatagactcacctcacaaatatctgtgtgtgatactag
GGAGCTCCTGGAAAAGATGGTGAAGTTGGTCCTTCTGGTCCT
gtgggcccgccggtatgtgatttttgtgtgtgtgtgtgtgagaatatatatatacacaca
ttgcattttttcgatgatgtttgttcaagacttatgggtaagtttcagggaaagtgaata
agaatgtatgggaatgaagaatttctgttataccttctcttttgatttctgtgagataat
EXON 30  46 bp
ccagagacttcaaacaataccatttggttactattaatactagtttattacctggctaaa
gagaaaaacatgtgattggaagaaatacaaataaatatcagtacttctagtggttcacgt
agagaggaagcagacaaagatctggttatattcacaattattttctccttcacaacttag
GGTCTAGCTGGTGAAAGAGGAGAACAAGGACCTCCAGGCCCCACAG
gttttcaggtatgcactaattcggttttccatttcatcttccattaactaaaatgctttt
tttttttaaaaaaaaagatatggtcagaagatttgaaattctacaattttcaaaaagtca
tccctcttttagtagatagtatagacatttggataaaatcgaacatttttgttcaaagta
EXON 31  61 bp
gtgttttattggtagtctttttttaatgcttctgaacaatattttttacttaaaatgtct
gaacaatatattttcattgaaaatatagtcttggagaccccatgaattgtaaaaggtaaa
ctgttaacactggtagcctgttaaacttacacagattcacaattttattttcttactttt
GTTTTAGGGGCTTCCTGGTCCTCCAGGGCCTCCTGGAGAAGGTGGAAAACCAGGTGATCA
A
gtaagtgtttaaataataataatggcaacactatacattgctggctcaattatcactttt
tatgtgtgaggctctgttgtgctttcctttacatacattatctctttgagttctcaaagc
agccctatgtactaggtactatcattatctccattttgtagatgaggaaaatggggcata
EXON 32  45 bp
aaaacatgtaatattccctcatttataaaaatatacgtacttttctttctttaaattgtt
ggcttatgcagccttctaatggcacattaatagaaactaggtgtatgaactggaaagttt
tctgataaatgcctaaactcaaagctcttgttccattaaaaaaaaaaaatgtgtttatag
GGTGTTCCTGGAGATCCCGGAGCAGTTGGCCCGTTAGGACCTAGA
gtaagtattttaatcttcatgattaatgttgtttcccactggcttcagttttaaaaggtg
tcttttaaaatcttaaactgggatttattttaacctataaattctttgactggataaaaa
ttaattttatgagaaatattttgtgctatgaaactagcatatccttacttcaaatttatt
EXON 33  99 bp
tgtgctatgaaactagcatatccttacttcaaatttatttcttatcactaaattagaaaa
ttgagatttagtaatgtctcatttctgaatttttccgcagtagaagccatttctcagaaa
cattttgacctatttttagatcaagtattgagattatttgacatcccaattttgtgctag
GGAGAACGAGGAAATCCTGGGGAAAGAGGAGAACCTGGGATAACTGGACTCCCTGGTGAG
AAGGGAATGGCTGGAGGACATGGTCCTGATGGCCCAAAA
gtaagtgtcatagtgatctcagtgttttaaaatgctttaaaattactgcttaataaacgc
atgatggtgtgagaatgcatttgtcttgtttttgaaagataatttgattatatcattttc
ttcttccacaaatatttaatgagcgcttactaggctttttccttgcaactaaagtgtcag
EXON 34  108 bp
ctggtttttttaatttcaaaatatcaactcactcagagacaactttctcagatgaaaaat
ataagcactaagttgaactacatgaaattgctgacaactacttttgacccactaaaaagc
aatttcattagtttaatcttaatattattggtatggtcacttaatgttggttcattttag
GGCAGTCCAGGTCCATCTGGGACCCCTGGAGATACAGGCCCACCAGGTCTTCAAGGTATG
CCGGGAGAAAGAGGAATTGCAGGAACTCCTGGCCCCAAGGGTGACAGA
gtaagtcctttttttttttttttttttttcagttcatttattcagactttctgctgaaaa
tgaaatgatttcttgagcaggcttttatttctaccatcctgagtcactagtcattcattt
ttcattcttctaataaacatttactgagaaaatgcacagtgtgaggcaccatcccaggct
EXON 35  54 bp
ttcatttttcattcttctaataaacatttactgagaaaatgcacagtgtgaggcaccatc
ccaggctcacctggatacgactaggaaaatgacaattagccttcactctcatgaaactta
cacacaagtgtgggaaagagacaattaaatgaatcaattgtattttgtgtgttttcccag
GGTGGCATAGGAGAAAAAGGTGCTGAAGGCACAGCTGGAAATGATGGTGCAAGA
gtaagtgaaagtattccttttctagctgggctaggaaccaacattacagtatcatatgag
tttccctgaaccttccaaaataaagtcagtcatgtttccttggtagtcaggagttggaga
ataatggcatgtgagatctgctgtgattcaaccacggtttattcattttgcttaccctga
EXON 36  54 bp
ttaaactagacagaaaactcttgaaaatatatagattatatcatttattatagataatga
tttgcaaaggcagccaaattataacaaaatagtcgtttcttttttgtttgttgatttgct
aagcatgaagatttctgtgcattttttacctcaatatgcctatgttctgttaattgacag
GGTCTTCCAGGTCCTTTGGGCCCTCCAGGTCCGGCAGGTCCTACTGGAGAAAAG
gtaagtcacaagttgttaatttgtacactcaaaattatgagtcctgaatagcaggctctt
tcataaatcttttcattttataacatatggtatctgagcaagatcatttcagagttcttt
tccactatctcctcctacacagtgaccaatgtcctaaaattatgtttagctactgttttg
EXON 37  54 bp
aaaattatgagtcctgaatagcaggctctttcataaatcttttcattttataacatatgg
tatctgagcaagatcatttcagagttcttttccactatctcctcctacacagtgaccaat
gtcctaaaattatgtttagctactgttttggacagtaaccatctaaaatctgctttctag
GGTGAACCTGGTCCTCGAGGTTTAGTTGGCCCTCCTGGCTCCCGGGGCAATCCT
gtaagtgacagtattttggtgttctttagtgtgagattgagcaataaaacaattaatcat
tttgtttttatatttatataaaacaatgcttattggttttaggttatgtataacttcctg
gtttttagcttttgcttttctaattaaacttaaaaattatctgctatacaatctattaag
EXON 38  54 bp
ttgggaattttgttctatgacctatatctttatataatccttaaggaccttccttaagca
atatgtgtaatttttctatatttacatgtctaactatcagatttatatgatcatatttta
aaatactgttcctgtttaggataatgtgtgaaagctacagtaatctttgtctcctcctag
GGTTCTCGAGGTGAAAATGGGCCAACTGGAGCTGTTGGTTTTGCCGGACCCCAG
gtataattttcaaatatccctaatttacaaataaacacttatcttgttataataagttta
atgatcattgtcatatgttttgaagtcgtattctggaaaatttacagttttctagacaat
attctcattttcaatacatttttttatagactggcacaaaacttgtttgtgctagttgag
EXON 39  108 bp
ttttttaggctgttttgaaagatctcatcagagtactttttttcctttagtatgctttaa
tactgattataaagcactgtttcacaatatatgattaattgatacattagtaataattac
tctaaagtaatttgtctataagtcttataatcaattgcttgtttgtataattttttatag
GGTCCTGACGGACAGCCTGGAGTAAAAGGTGAACCTGGAGAGCCAGGACAGAAGGGAGAT
GCTGGTTCTCCTGGACCACAAGGTTTAGCAGGATCCCCTGGCCCTCAT
gtaagttaacaagaaaaaggcataacttgagtcaagtgccccatgtttggagtgtacatt
cagcctcttttgcttcactatagtgctcttttgtttgtttctattcagggtcctaatggt
gttcctggactaaaaggtggtcgaggaacccaaggtccgcctgtaagtttatttgatgct
EXON 40  54 bp
ggagagccaggacagaagggagatgctggttctcctggaccacaaggtttagcaggatcc
cctggccctcatgtaagttaacaagaaaaaggcataacttgagtcaagtgccccatgttt
ggagtgtacattcagcctcttttgcttcactatagtgctcttttgtttgtttctattcag
GGTCCTAATGGTGTTCCTGGACTAAAAGGTGGTCGAGGAACCCAAGGTCCGCCT
gtaagtttatttgatgctctgcaaagtatgcacagctaattctagttacctagtgcttcc
tggtcatgtaaaagataattttcatctgagactgaaataacaaattattacctgtatcaa
ctgtactatagtgcaaagggcacttaactcagatggagatttgggttaaaatcaagtttg
EXON 41  54 bp
accagttaatctagattaattccccaaaatatgggattcgtacgaagaaaaaaaaatatt
gcttacaacatgaaaggaaatctaaaggcttcagtcttcctgtgaaaaaaaatcccagga
aaatacatgtaactaatttatattaccttaaaaattgcttatatgatattctggttctag
GGTGCTACAGGATTTCCTGGTTCTGCGGGCAGAGTTGGACCTCCAGGCCCTGCT
gtaagtcaacttagtgagacaagtcactgataatgaaataattacacacacacgtataca
tttgagttaaatttattattttatttaatttcttaatggtatgttttcttatttaacaac
tcttattccaataatgcatgctggtatttcagcaaagcaaatcatccttaataatctagt
EXON 42  162 bp
tacagctgtgttttcttttgttttgttttgtttaaatcctatagaatgactgattatcta
acaggtaaaatgaacctgcgaggcttggacatctgcatctgaggcagacagcgttatgtc
aatcactcttacttgccttccattttgccctccttggtgtttctttctttgttatactag
GGAGCTCCAGGACCTGCGGGACCCCTAGGGGAACCCGGGAAGGAGGGACCTCCAGGTCTT
CGTGGGGACCCTGGCTCTCATGGGCGTGTGGGAGATCGAGGACCAGCTGGCCCCCCTGGT
GGCCCAGGAGACAAAGGGGACCCAGGAGAAGATGGGCAACCT
gtaagtttggcgtatccgttccagaccaccttcaactgagatatttacaaatagaaaccc
ataatgatcagtgtcacaaaaatgcttaaatattatgctgggcacattcctaaaattttt
aaagtgcattaaatctataaggctttaggaaaaacgtgtatatatatagattttaaaaat
EXON 43  108 bp
atgttagaggttctgtgcggattacaatttatgactactcatatgcagtatgattttgag
aaacagagaacttctttttcatactgaaaaacctgtaaagctgtacccaacttattgtaa
attccttgggtacagttttaccctggatagtttctgattttagtttgtcctcaacattag
GGTCCAGATGGCCCCCCTGGTCCAGCTGGAACGACCGGGCAGAGAGGAATTGTTGGCATG
CCTGGGCAACGTGGAGAGAGAGGCATGCCCGGCCTACCAGGCCCAGCG
gtgagtagctgcatcggtcaatattttatctcatatgtgcaatacaaattgtttagagaa
ttgattttattttttttgcttgatgaatagatttaaacagtattgtagggacattaattt
ttgagtctcttaaaaatcttttgatcttaaatgtcaaattcttaactaccttacaaagtc
EXON 44  108 bp
gtctgataggaggtgggcaggcctctaagaaagcattatgattacatgagtgttgtaaga
taatgcaaaattattattatagaaggagcccagaggcaccattttgaaaacttagccttt
atgggaactagcgttcttcaatttcttcacaagtgtttgacatttatacttctatttcag
GGAACACCAGGAAAAGTAGGACCAACTGGTGCAACAGGAGATAAAGGTCCACCTGGACCT
GTGGGGCCCCCAGGCTCCAATGGTCCTGTAGGGGAACCTGGACCAGAA
gtgagtactacagtgaaaataactcttctcttgttatctggtgtcatggaaacaattttt
ttcatttagcaattgatttagaattttattgcatatttgaccttaagaaagtttcttagt
aatgttatttgatgtactctacttccctagagagttggctaagtgatgacataaagaaaa
EXON 45  54 bp
tacagtaattcaaaataatgaaaaagaggtagaaaccgttcttctgctgacatttgcata
aatgctaactgacagtttataaaacacaggtgtaaaacatgctgtcattttttgacaatt
ggaatgaggatttttttcattactcagttaagtagtttttcaaaccattattctttatag
GGTCCAGCTGGCAATGATGGTACCCCAGGACGGGATGGTGCTGTTGGAGAACGT
gtaagagccatttcacttattataaaatctaaagtcatgcaaatctgaaatctttttaat
ttacactaaaaactgtcatttttcctgatagttccaatacacttctgatttttctgaata
acaactgtttctgtaaagccataatttttatatcttgtaaatgaaatgatatttgaatat
EXON 46  108 bp
ttcttttcaatttgatttattaattaataaatataagtaaaatagttaaaataataagta
aaaataagttttaaagggtattttttcccattattaatactataagaataacatgaacat
atggaatattgttgttttagaataaatgttaaaaaataatatcatggttattcttgttag
GGTGATCGTGGAGACCCTGGGCCTGCAGGTCTGCCAGGCTCTCAGGGTGCCCCTGGAACT
CCTGGCCCTGTGGGTGCTCCAGGAGATGCAGGACAAAGAGGAGATCCG
gtaaggagggagtcaatttcacactgacagttttgcacacccatatgctatgttataagc
tgcatataggcacacacacatagtcatacatgtgcacttcgttaaggactctaaataatg
aatggtaaacagctaattatgaactactatatgtttcttagtctgaaaggcaaaatttca
EXON 47  54 bp
tacacatggacatttgcctgatttcaattaattaatcataagagtatgcacacacacaca
cacacacacacatatatatatatgcatccaactataaacgtattgttgacatcctgtatc
tatgtaatatgtgaatatcttttttacatgccaattttttttgttgtaaatttcttttag
GGTTCTCGGGGTCCTATAGGACCACCTGGTCGAGCTGGGAAACGTGGATTACCT
gtaagttctctttttttgttttttaaaaaatgttttcttatataaaatatactcccaaag
aagtataatttaagattcataactgaaaaatatgaaattcctcaagcttgaacaaaaata
ttaattaaaaattataagtttactcttattttttaaagtaatacgagtttatttttataa
EXON 48  108 bp
aaaaataaacagaaatttctaggtctaatactatttttagataagtaaatatattaatcc
atataaaataccaagttcaaaattgtagtaaatacaattataaaaagtaaaattttagta
aattttagtctcaacaataatatgtagcaagtaattttcatgccatatctctatttctag
GGACCCCAAGGACCTCGTGGTGACAAAGGTGATCATGGAGACCGAGGTGACAGAGGTCAG
AAGGGCCACAGAGGCTTTACTGGTCTTCAGGGTCTTCCTGGCCCTCCT
gtaagttattcctttaagtattattctgccctgtagttgaaaatacacgggtatcttgac
acgaacatttatctgtctgtaaaataggtggatatgtttgtatcttattttcagttcaaa
gaatatcttgatgaataacaagtgataattgccaataataagctataattttgtagggaa
EXON 49  54 bp
atatgcactgttactcctacaggtgtctttaacattggtcaactcatgtagacattgcag
agattggtgactttatcaaagtagttcatgctgctaaagtcaatgatagcacatttttga
gaatggcacaatgcaggatccaaatattttggcaacattttttattgtattcctacttag
GGTCCAAATGGTGAACAAGGAAGTGCTGGAATCCCTGGACCATTTGGCCCAAGA
gtaagtaacaaaaagtagtaagttgcaggtgtaaataataatgcctttgttgatgtactg
ctaatgcttgagtatcgttttcctggtattgaagctggagttggctcatcttctctgagg
ttggcaacacacatatgagacaagctatttagcaattaattttaagtagaaatatcttga
EXON 50  108 bp
tcttatgtgatgaaatcataaatgttacaaagtaccagaagttcatttattaatcagtaa
gaaaatgaatcttagaaatcactgttacagctccatatgtaaaatagttctttgattaga
gaaaggcattgtaaaatttttccttcatagaatctaaactacagtctttgtttcttgcag
GGTCCTCCAGGCCCAGTTGGTCCTTCAGGTAAAGAAGGAAACCCTGGGCCACTTGGGCCA
ATTGGACCTCCAGGTGTACGAGGCAGTGTAGGAGAAGCAGGACCTGAG
gtaaagtcacaaaggtttacatgcaagaaatgctatttattcaatagctcagattccgtc
caagaaatgtctgtgcagcccgattgacaagagacttaagggaccccgaaaacaaacgta
gaagtcacacaagagtataagtaactatttcaagtattttaatacagataagttagagca
EXON 51  292 bp
atccttgaatgttacagcctgttagaccacccccatctagttacaaaagggcgcgagtca
tagatctccctttactgtcaaattggagtgtctcattggaactccctatgaaccaagttc
taccagttaagtaaaacaaaaacaatgtgttaaatgtctttccaatctctttttaattag
GGCCCTCCTGGTGAGCCTGGCCCACCTGGCCCTCCGGGTCCCCCTGGCCACCTTACAGCT
GCTCTTGGGGATATCATGGGGCACTATGATGAAAGCATGCCAGATCCACTTCCTGAGTTT
ACTGAAGATCAGGCGGCTCCTGATGACAAAAACAAAACGGACCCAGGGGTTCATGCTACC
CTGAAGTCACTCAGTAGTCAGATTGAAACCATGCGCAGCCCCGATGGCTCGAAAAAGCAC
CCAGCCCGCACGTGTGATGACCTAAAGCTTTGCCATTCCGCAAAGCAGAGTG
gtgagtagacagcagcccatttgagcaaaacccgttgtttctgattgtttattctcaact
gcattccaaaatatgttactgactttctacttagtgatagatttgagataaaaatagtaa
acatatcatggagcttataatttaatggtggaaacagtcaattttgtgaaaacatgaaaa
EXON 52  188 bp
actagaatgtagaaaggcccccaatgcataccggttacttttttcgtaaggggcactctc
acttaaaagaatccttaatcagtgagtgtatattttcaaaccctctgttaattcttttgg
agacttatagtcatgattgagattgtctttatttagtaaaatttctattttgaaaaatag
GTGAATACTGGATTGATCCTAACCAAGGATCTGTTGAAGATGCAATCAAAGTTTACTGCA
ACATGGAAACAGGAGAAACATGTATTTCAGCAAACCCATCCAGTGTACCACGTAAAACCT
GGTGGGCCAGTAAATCTCCTGACAATAAACCTGTTTGGTATGGTCTTGATATGAACAGAG
GGTCTCAG
gtaatttaatatgtttacttaaaattgtattctttactttttactacttattacatattt
ttgatttatttaggactttgctatttttttaaaccaggcttattttaccatgtttatttt
gaagtgatatagtctcattagttacaattgtaataccattgcataaacaaggttttgcta
EXON 53  240 bp
atagacattttaagatatgtttagatgtacagctagaatagcttactttatgacaagaat
taaagtaatactcttcaaaattgatttatctgaaatcaatttatatatttatctatacat
gtgtaaggcattatgaaacccttcagtcttgtgtatgacaaagactctttgtttttctag
TTCGCTTATGGAGACCACCAATCACCTAATACAGCCATTACTCAGATGACTTTTTTGCGC
CTTTTATCAAAAGAAGCCTCCCAGAACATCACTTACATCTGTAAAAACAGTGTAGGATAC
ATGGACGATCAAGCTAAGAACCTCAAAAAAGCTGTGGTTCTCAAAGGGGCAAATGACTTA
GATATCAAAGCAGAGGGAAATATTAGATTCCGGTATATCGTTCTTCAAGACACTTGCTCT

gtaagtactttttgatctacattgatctggttgaggaaaaaaaattatttttgttaaaaa
tactattacagcactagaactgggggcaattttaccttgtatatgagcataatagcagtt
tgtttatagtcattccttagggtaaatgtgtgtgtgttagcacatgaagcatgatagagg
EXON 54  1702 bp
tgaaagaaattctgttacataagtacactaatatttcactttatgttttcattccttttt
tttaagtagtactctaaaaatcattgcctttacattataaaagtgtctgggaaggttgct
gtctaacatacttggaaaaaattgtatgtacatttaacccattgcatcatttaatttcag
AAGCGGAATGGAAATGTGGGCAAGACTGTCTTTGAATATAGAACACAGAATGTGGCACGC
TTGCCCATCATAGATCTTGCTCCTGTGGATGTTGGCGGCACAGACCAGGAATTCGGCGTT
GAAATTGGGCCAGTTTGTTTTGTGTAAAGTAAGCCAAGACACATCGACAATGAGCACCAC
CATCAATGACCACCGCCATTCACAAGAACTTTGACTGTTTGAAGTTGATCCTGAGACTCT
TGAAGTAATGGCTGATCCTGCATCAGCATTGTATATATGGTCTTAAGTGCCTGGCCTCCT
TATCCTTCAGAATATTTATTTTACTTACAATCCTCAAGTTTTAATTGATTTTAAATATTT
TTCAATACAACAGTTTAGGTTTAAGATGACCAATGACAATGACCACCTTTGCAGAAAGTA
AACTGATTGAATAAATAAATCTCCGTTTTCTTCAATTTATTTCAGTGTAATGAAAAAGTT
GCTTAGTATTTATGAGGAAATTCTTCTTCCTGGCAGGTAGCTTAAAGAGTGGGGTATATA
GAGCCACAACACATGTTTATTTTGCTTGGCTGCAGTTGAAAAATAGAAATTAGTGCCCTT
TTGTGACCTCTCATTCCAAGATTGTCAATTAAAAATGAGTTTAAAATGTTTAACTTGTGA
TCGAGACCTACATGCATGTCTTGATATTGTGTAACTATAATAGAGACTCTTTAAGGAGAA
TCTTAAAAAAAAAAAAACGTTTCTCACTGTCTTAAATAGAATTTTTAAATAGTATATATT
CAGTGGCATTTTGGAGAACAAAGTGAATTTACTTCGACTTCTTAAATTTTTGTAAAAGAC
TATAAGTTTAGACATCTTTCTCATTCAAATTTAAAGATATCTTTCTCCTCTTGATCAATC
TATCAATATTGATAGAAGTCACACTAGTATATACCATTTAATACATTTACACTTTCTTAT
TTAAGAAGATATTGAATGCAAAATAATTGACATATAGAACTTTACAAACATATGTCCAAG
GACTCTAAATTGAGACTCTTCCACATGTACAATCTCATCATCCTGAAGCCTATAATGAAG
AAAAAGATCTAGAAACTGAGTTGTGGAGCTGACTCTAATCAAATGTGATGATTGGAATTA
GACCATTTGGCCTTTGAACTTTCATAGGAAAAATGACCCAACATTTCTTAGCATGAGCTA
CCTCATCTCTAGAAGCTGGGATGGACTTACTATTCTTGTTTATATTTTAGATACTGAAAG
GTGCTATGCTTCTGTTATTATTCCAAGACTGGAGATAGGCAGGGCTAAAAAGGTATTATT
ATTTTTCCTTTAATGATGGTGCTAAAATTCTTCCTATAAAATTCCTTAAAAATAAAGATG
GTTTAATCACTACCATTGTGAAAACATAACTGTTAGACTTCCCGTTTCTGAAAGAAAGAG
CATCGTTCCAATGCTTGTTCACTGTTCCTCTGTCATACTGTATCTGGAATGCTTTGTAAT
ACTTGCATGCTTCTTAGACCAGAACATGTAGGTCCCCTTGTGTCTCAATACTTTTTTTTT
CTTAATTGCATTTGTTGGCTCTATTTTAATTTTTTTCTTTTAAAATAAACAGCTGGGACC
ATCCCAAAAGACAAGCCATGCATACAACTTTGGTCATGTATCTCTGCAAAGCATCAAATT
AAATGCACGCTTTTGTCATGTC
agtggtttttgttttgtgaaattcctttgaccatattagatctatttcatttccaatagt
gaaaaggagatgtggtggtatactttgtttgccatttgtttaaaagatacaacggatacc
ttctatcatgtatgtactggcttataaatgaaaatctatctacaacattacccacaaagg