Gene CNNM4 Variant 1
DNA : 50.73 KbNT_026970
mRNA : 4539 bp NM_020184
CDS : 1896 bp NP_064569
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1259 bp
gcgcggggagcggcggcggcggcagagccagagcaacatggcgccggtgggcgggggcgg
gcgcccggtcggcggaccggcccgcgggcgcctcctcctggcggcgccggtgctgctggt
gctgctgtgggcgctgggggcccggggccagggcagcccccagcagggcacgatcgtggg
CATGAGGCTGGCGAGCTGCAACAAGTCGTGTGGGACGAACCCGGATGGCATCATCTTCGT
GTCCGAGGGCAGCACCGTGAACCTGAGGCTGTACGGCTACAGCCTGGGCAACATCTCCAG
CAACCTGATCTCCTTCACCGAGGTGGACGATGCCGAGACCCTCCACAAGTCCACCAGCTG
CCTCGAGCTCACCAAGGACCTGGTCGTCCAGCAGCTGGTCAACGTGAGCCGCGGGAACAC
GTCCGGCGTGCTGGTGGTGCTCACCAAGTTCCTCCGGAGGAGCGAGAGCATGAAGCTGTA
TGCACTGTGCACCCGGGCCCAGCCCGACGGGCCCTGGCTGAAGTGGACGGACAAGGACTC
ACTGCTCTTCATGGTGGAGGAGCCTGGGAGGTTCCTGCCTCTCTGGCTGCACATTCTCCT
AATTACGGTGCTGCTGGTGCTGTCGGGCATATTTTCTGGCCTCAACCTCGGGCTTATGGC
CCTGGACCCCATGGAGCTGCGCATCGTGCAGAACTGTGGCACCGAGAAGGAGAGGCGCTA
TGCCCGCAAGATTGAGCCCATCCGGCGCAAGGGCAACTACCTTCTCTGCTCGTTGCTCCT
AGGGAACGTGCTGGTCAACACCTCCCTCACAATCCTTCTAGACAACCTCATCGGGTCCGG
CCTCATGGCGGTGGCCTCCTCCACCATTGGCATTGTCATCTTTGGGGAGATCCTACCTCA
GGCCCTGTGCTCCCGACATGGGCTGGCTGTGGGTGCCAACACCATCCTTCTCACCAAATT
CTTTATGCTACTCACCTTCCCCCTCAGTTTTCCCATTAGCAAGCTCCTGGACTTTTTTCT
GGGCCAGGAGATTCGCACTGTTTACAACCGGGAGAAGCTGATGGAGATGTTGAAGGTGAC
GGAGCCCTATAATGACCTCGTGAAAGAGGAGCTCAATATGATCCAGGGTGCCCTGGAACT
ACGGACCAAAACTGTAGAGGATATCATGACCCAGCTCCAGGACTGCTTCATGATCCGCAG
CGATGCCATCCTGGACTTCAACACCATGTCGGAGATAATGGAAAGCGGCTATACTCGCAT
CCCGGTGTTCGAAGACGAGCAGTCCAATATTGTAGATATTCTCTACGTCAAAGACTTGGC
CTTTGTGGACCCCGATGACTGCACCCCCCTCAAGACTATCACTCGCTTCTATAACCACCC
GGTGCACTTTGTCTTCCATGACACCAAGTTGGATGCCATGCTGGAGGAGTTCAAGAAGG
gtaaggccagatgtagttcccctggttcaatttcctcttgacgcctcttttcccctggcg
tgttttgtgtctgctggctttagtgttctgtttgtgtgactctgtgtccctttgcctatc
gcttcctatgcttctgaggtgaacgattttggagcggtagacccattctcaagtgtctgc
EXON 2  144 bp
tccttttcataaaagcaatgtctgtttgcagtagaaacgtcaggaaagatggaaaagata
aaaaccaccatgaccccatcctggtgacttatgaccctacgtctagagttaatgttttgg
ttgagggagtctcatgactggcctctgggctcttgtctgacttgctgcattgtcccacag
GGAAGTCCCACCTGGCCATCGTGCAGAAGGTAAACAACGAGGGTGAGGGTGACCCCTTCT
ACGAGGTCCTGGGCCTGGTCACCCTGGAGGACGTGATCGAGGAGATCATCAAGTCGGAGA
TCCTGGACGAGTCCGACATGTACA
gtgagtccagccttccacagggcccaggacccctttcctgcttggatcgaaacttggtgt
ccctagctggaagggccatagtgcagggacacaggaggcctagcatccagaggcccagtg
gctgggtgccctgcactggccggggtgagcagggagcaggttgctgagagcagtgcccgg
EXON 3  135 bp
cggaggctgccttcaccctcggcctttgtgcctcggcgtcagcccaggaccctgccagcc
agagcctgctgctcctgcgtgggactaggggctggagagcaggagctgcggggcgggttc
cagtctcttcctaagtcctcaggggtctgtgttctcaattccacgctcttcttccggcag
CTGACAACCGAAGCCGGAAGCGGGTGTCTGAGAAGAACAAGCGTGACTTCTCTGCCTTCA
AGGATGCGGACAATGAGCTCAAAGTGAAAATCTCCCCGCAGCTCCTCCTGGCCGCTCATC
GCTTCCTAGCCACAG
gtagcatgaggaggaccttccggtcttggtggaaatacggtcacgggggagaagtcctgg
gtttccggctgctttccccccataggacgagggctgcagcaggtgaggggtgcagagaca
acacagccacccctggaaggggccgggtatctgctccacccctggggatctccctgcgat
EXON 4  170 bp
ccagtcagaagccaagcgtgctccctccccagggaggtgcagaacgagggccggccgagc
agggcgggagtcgtctgagcacagcgtggctgctgtggttggggtggaggcacagcagtg
atcgagctttagggccacctggccagccccgtgtgaggtctcttctctctcctcctacag
AGGTCTCTCAGTTTAGCCCCTCCCTGATATCAGAGAAGATCCTGCTGCGGCTACTCAAGT
ACCCAGATGTCATTCAGGAACTCAAGTTTGACGAGCACAATAAGTACTACGCCCGCCATT
ACCTGTACACCCGAAATAAGCCGGCCGACTACTTCATCCTCATCCTGCAG
gtgagcccgctcagccctgggcctgccacctgctccccctggcactgcagcaacccccag
gccctctctcccacctgctgcggaggtgcatggcttccctgcctggggagcctgctgcct
gcccttgagccccgcctgccccacgtggccatcctctccctgagaggccactcttgatct
EXON 5  97 bp
tggccatcctctccctgagaggccactcttgatctcacaggtcaggcccctgagctctcc
agggctccagtaccggcccttcctcctgccccactgtcccttgttcctcactccccatcc
tgcctcatcctttgtttcctccctcacttggtctctaactccagccctgtgttttttcag
GGGAAGGTGGAGGTGGAGGCAGGGAAGGAGAACATGAAGTTTGAGACGGGCGCCTTCTCC
TACTATGGGACTATGGCCCTGACCTCGGTCCCCTCCG
gtgagttgttgggcatggtctttgctgccctttggcccccctgcagctggggagccatgg
accgacaccagaactgagcatgggcccgagagctcatagccagctggctggggcagaggg
aggctggtgaggcgggagccgccagggcctggagcgggtggtgtggaagagcagagggag
EXON 6  182 bp
tgctttaacgaagtcagaccttatgcagtcagaccttctacatgcttctgtttgtcccta
agaatgacttcctgttcctgggtggggtgtccctgggcttccatgggatgaggtgagaca
tgagggtgagagtgggcatcggagtggcctttggcatgacaacctctgctctccctgcag
ACCGTTCCCCAGCACACCCCACCCCACTCAGCCGCTCAGCCTCCCTCAGTTACCCAGACC
GCACAGACGTCTCAACTGCAGCAACCTTGGCAGGCAGCAGCAACCAGTTTGGCAGCTCTG
TCCTGGGCCAGTACATCTCTGACTTCAGCGTCCGGGCACTCGTGGACTTGCAGTACATCA
AG
gtgagtgcctcactgccctgtctgggcagtgctatcttctgctcaggaatcagctactac
tttcatccaccaaacccagcatggtgggcccaaacccgagatgcctttttcttctggaga
tggggtcttgctctgtcgcccaggctggaatgcagtggtgtgatcatagcccacttcagc
EXON 7  2552 bp
ccctgagatgctttcttctcttgttcgtgcaccttgttctttgtaagggcttccagagac
gctgactggtcatgttctctctcaactcacagcctcaatcctggccctgtttctccaggc
ctggtgatagggtctgcctcccagcccctccctccatgaactcatcccttcctcatgcag
ATCACTCGGCAGCAGTACCAGAACGGGCTGCTGGCTTCTCGCATGGAGAACAGCCCTCAG
TTTCCCATAGACGGGTGCACCACCCACATGGAGAACTTGGCCGAGAAGTCTGAGCTGCCT
GTGGTGGACGAGACCACAACTCTTCTCAACGAGCGTAACTCCTTGCTGCACAAAGCCTCC
CACGAGAATGCCATCTGACAGGAGGGCCCGGGGCCCCCTGCCCACCCTGCGGGGGCCTCC
CCAGTGGGCCCACATGAAGAGAGGGAACCTGTTAGTCCAGAAAGGATACGGATAGATAGC
CTGTCTGACTGAACAGCCAGATGGCCCCCAGCCTATGGGGGATCTGGCCTCTGCCAGGGA
CCTCTGAGTAGCTCTGAGGTGGCACTGTCCAGCCCTGGATAGGGGGGGCAGTGGGCCAGC
TACCGTAAGCAAAGGCTGTTTTTTACTGAGAGAATTTCTAAAGTAGGCTCATCACTTTTT
TTTAAATATCATTTTGGGAAGGGAAGACAGGGTTAAGGAACTTTATTTAAAAAAAAAATA
TTTTTTTCCTAAAAACTATAAAAGAGGAAGGGTTTCTTGTCCCGGGAAGCAACGGACATA
ATCTGTTCCCAGCCATGGCCTTCCAGCTTGTGTCCCTGATTCAGGGAGCTCTCCCTTCCT
CCTCCTCCTCCTCCTCCGGAGGTGGGATCCCAGAGCCTGCCAGTGGAGGCTTATCTGTTG
GGAGGAAGACAGCTCTTCACAGAAGCAAAGAACAAAATGGCATGGAGATCAGCTGCCTGA
GCACCTGCGCTGTAGCTTATCTGACAACGCTGAGGCCACGAGCTCCTGGGTAGCTGTGAT
CAGGGACATGATAATCTGAGCTATGCAGAGGAGCACATCTGTTGTCAACTGCTGTACCCA
GAAATCTAGAACTCTGCCGACAGCCTCTCCTGGTGAGTCGGGACTCAGCTGAGGACACAT
CCCCACCCTGCCTCCCATCTGGCCCTTTGGACAACTGGCCCTTTGTGACAGGGCTGACTC
AAGTGTTAGGCAGGGTCTCAGGCCTTTGATTGCTCACCCCTGCTCCCCAGGCCCTGCCCT
CACTTTTACCAAAGGTTCTCCCTCGGCGGGAGGGCATCTGTGTTGGAGGTGATTTGTCTG
GGTTCTTCCTTTTGGTTCCAGAAGGAACTGTCAGTCATCAGCATCTGCGTTGTTAGCAGT
CAGTACCACCCCCGCCCCACAATGACAGTCAAGGCTGACTTGTTGACTGAAGCCTTTTTC
CCAGACCCCTTATTTCGAATCCCCAAGCTTCAGTCCCTCTTGGGGGTGGAGACAAGAGGA
CATGTGGGAAGCCACGGAAGCAGGTTCTTTATGTCCTCTCCTCTGTGGCTGGCAAGGCTC
ACCTGGCCTTATCCACCCACTTATGGAACCTCAGGAGAGGAGGGCTCCTCCTAAAGGCAT
GCAGCTTGCAGCCCCTCTTTCTCACACGTGTGATCCTAGCGTGAGAGGTCATCCTGCCCT
TGCTGAAGTTAGTAGTACTGTACTAAGAGCTCTGCCCTCATGTGAATTCCTGCCCTGGCG
CCTCTTCCCTGGGGCTGAATCAGGCCCTGCTGCAAAACTCCAGGCTTCCCAGGGTTGGGG
AGGCTGTGGGACCAAGGTCCATGTTGGTCCTTCCACTGGGTGCAGCAGGAGCTGGGTCCC
GAGAGCCTGGCAGGTGAAACTCTGCAGGCCTTCCGCCTGATTATTATTTATTCACTCCTT
TCCTCACCCCAAGTGCCCTGCTCTCCAGGTGCCTAGAGTATCCTAACTCTTAGGACCAGG
GATTGTCTTGCACCAAGTATGCCTACCCCTGGCCAGTCTGAGGTCTCCTAGCCATAGAAC
TGACTCCTGGAAGCCTGGAGAGAAGGTGGTGACACCCATGGGTTCTCAACTGTAAGGAAA
AAAGACACCAGACTTTTGTTCCCTAGTGGGGGAAAGCCCTTAGTCTTGTACAGGAGCAGC
TTGCTCCCAAGTCCTTTTGGAAGCTGGCAGAGCTATATTCCTGACAGCCCTGACTGCCAG
GTAGAGCAAAAGACATTGGTGGGGGTATGTGAAGCAAAAGGGGCAGGTGCACACACCTCC
ACAGTGACCTCTGTGCACACGGTTACCACCAACTGGCTGGCCCTCCTCCTCTTCCCTGGC
CCATTGATCATCCCTTCTCACAGAGGGTCATCATTATTTCCAAATATTGTTTGTCTGATG
ACTTCCTCTTCCCAGTGCAATTTTTCCCTTCCTATTTCAACCTCTGGTTCCTGGGATGAG
CCATACCCTGGAACTGGCCCACCCACTGTGTCTTCCACGTAAGGGAGACCTTTGCAAAGG
GCATCCAAATGGGTAGGCAGGTGACAGCCGCCGTATTTATTTTGCATAATATTTTAATTT
GTATATTTTTGTGATTTATTTTGGCGTTATGAGTTTGACTCTCGGGGAGTTTTGTTGTTA
TGACTCTTGTGTCTTTTGTCACAAAACAATGATATTTGCTAAACGATATATGGAATTTAT
TTTTGATTGGTAATAAAAAATCAAATATGTAT
aaatcctggtgaatctacaacttgcctgtttgttctgtcagtattcagtatgttgttgag
ataaaagtggctgtggctggctgtctcttgtgatgggacaagggcaataaaggattctag
gaccattcagcagtgaaatgcaatcagaaatggaatttctaaatatagtcaaggctgtcg