Gene CNNM3 Variant 1
DNA : 16.42 KbNT_026970
mRNA : 2204 bp NM_017623
CDS : 1149 bp NP_060093
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  348 bp
tcctggtgggagaggtggtgccggccgccgtgagcgggcgctggacgctggcgctggcgc
cgcgagcgctcggcctcagccgcctggccgtcctgctcactctgcccgtcgcgctgcccg
tggggcagctgctggagctggcggcgcggcccgggcggctgcgggagcgggtgctggagc
TGGCGCGCGGCGGCGGCGACCCCTACAGCGATCTCAGCAAGGGCGTGCTGCGCTGCCGGA
CCGTGGAGGACGTGCTCACGCCCCTCGAAGACTGCTTCATGCTGGACGCCAGCACCGTGC
TGGACTTCGGCGTCCTGGCCAGCATCATGCAGAGCGGCCACACGCGCATCCCGGTGTACG
AGGAGGAGCGCTCCAACATCGTGGACATGCTCTACCTCAAGGACTTGGCCTTCGTGGATC
CCGAAGACTGCACGCCGCTCAGCACCATCACTCGTTTCTACAACCATCCGCTCCACTTCG
TCTTCAACGACACCAAGCTGGACGCTGTCCTGGAGGAATTCAAGCGAG
gtaacggcccgggcatggtgcaggggacgcccgtgcgagtgccctctccctgaaaagggg
tggagagttatggaagccttctggaaagggtcccacccctgtggagagcagtgagacctc
taaggtcccttttcaagacggtattggccttgcagcttggaatgaccttttgaaatactt
EXON 2  144 bp
agttctcataatcacgctgggagtcttaagtaaaaacctagaaaagagtgtggctctgtg
cctggcacgttgtaggagcatgaacgttagccgtgtccttttggtgggcctataccaggg
gagatgaatcaaactggggggggcccagcaagctgttccatgagtgtcctccccccacag
GGAAGTCCCACCTGGCCATCGTGCAGAAGGTGAACAACGAGGGTGAAGGCGACCCCTTCT
ACGAGGTCCTGGGCCTGGTCACCCTGGAGGACGTGATCGAGGAGATCATCAGGTCCGAGA
TCCTGGACGAGTCTGAAGACTACC
gtgagtccagactcttggcagttctgtctccgctgggcctgcacacttccccaggcgtat
gttgcgtcagaggccagtgggcctctgtgctgctggaacccagcaagatccacagccagg
cccccttctgagccctgcatgggtgctggcagagagcccccttgcaggagggctcacgcc
EXON 3  150 bp
ggggtgggagcaggccccgtggagggagcggtgctgaggacatgtccctggcgttccgat
gctgctccatcgaggaccccctggcctcaggaggaaggagcaggcgatgcagccccttag
tgtggtcgtgttgactgacaggtggctgatgcctgagcgcgccctcttcttccatcttag
GAGACACCGTGGTGAAGAGGAAGCCTGCTTCTCTGATGGCCCCTCTGAAGCGGAAGGAGG
AGTTCTCCTTGTTCAAGGTGTCTGATGATGAATATAAAGTAACAATCTCGCCTCAGCTGC
TCTTGGCCACCCAGCGCTTCCTGTCCCGAG
gtgaggcgggagggtggtccatgccccctgctctcctcaccgttctgtgggtcaggaggc
cgcccagggccgacactgactctgctccccactcctagcaggcgggtgcgtcttgaggac
ttctgtgttctctgcagccctgccagcatcttgggtcatgggagagacacctcctctctg
EXON 4  170 bp
agccaccgcacctggcccctgcctagttctcttgtgttgaggtgttaggggcagctgctc
acaggccacccgggagatccctggtgggcacaataactttaaattgcctacagtgttggg
tgtggttccactggccactaggccccagtggacactgtcccttttttccaccacgtgcag
AAGTGGATGTATTCAGCCCGCTGCGCATCTCTGAGAAGGTCCTGCTGCACCTGTTGAAGC
ATCCCAGTGTCAACCAGGAAGTGAGGTTTGACGAGAGCAACCGGCTGGCCACACACCACT
ACCTGTACCAGCGCAGCCAGCCGGTGGATTACTTCATTCTCATCCTGCAG
gtagctgtgggtcccaggcctggagtccctcctgcttcctcaggccagggaagggtctag
gagaagaggggagcaggggcatgcggatatgcaccctcccaccccaaacaattgaggtgg
tgggtttctccttccgctgtcttctgacgggaaaggtaatctggccgcatctgtttctct
EXON 5  97 bp
cctggagtccctcctgcttcctcaggccagggaagggtctaggagaagaggggagcaggg
gcatgcggatatgcaccctcccaccccaaacaattgaggtggtgggtttctccttccgct
gtcttctgacgggaaaggtaatctggccgcatctgtttctctccttgccactcctcccag
GGCAGGGTTGAAGTGGAGATCGGGAAAGAGGGTCTGAAGTTTGAGAATGGGGCCTTCACG
TACTATGGAGTGTCGGCCCTAACTGTGCCATCCTCGG
gtaagccacggccctgctgatgctgagggccagggtggaggctgcagagcctgtccccca
tcatcacttgggctctcagtgcccctcctcacctctccttccacctgagcccaccacccc
acaaggtggtgtagcccctgggcttccaggagggagggcagcattcttcatcgctcaact
EXON 6  134 bp
tccacccctgcaaaacctctcccggctgtgtttgtccttctctcccagcttcccatgcac
attgcctctccagagtgattggtggggtgggtcttcgaaactgtacagttgtccccacca
ggggaggaggctcccagctgccagcatggctcctgccatcactgattgttcctttgatag
TTCACCAGTCCCCGGTGTCCTCGCTCCAGCCCATCCGCCATGACCTGCAGCCCGACCCAG
GTGACGGCACGCATTCATCTGCGTATTGTCCCGACTACACCGTGAGGGCGCTCTCTGATC
TGCAGCTCATCAAG
gtgactgcctgggctgcttgtgggtgctggctttagccgactttgtgtcaccgggggcta
gaccagctggtctgagactgcccggaacaaggccttccactcatcctgagggacacagac
ctttgcacccagtttccaagcaaggtcttaaaaacacttgactcagttgctcttctctgc
EXON 7  139 bp
cagacctttgcacccagtttccaagcaaggtcttaaaaacacttgactcagttgctcttc
tctgcccttaactagcttaaagttgtgcctctgtcctcttcgggcacggtgtcacctttc
ctgcctaccttctgcatctcgcttcaccaattgggtcccagtaacgctgtcatcctccag
GTTACGCGACTGCAGTACCTCAATGCACTCCTGGCTACCCGAGCCCAGAACCTGCCACAG
TCCCCTGAGAACACCGACCTGCAGGTTATTCCAGGCAGCCAGACCAGGCTCCTTGGTGAG
AAGACCACCACAGCGGCAG
gtgagtgccaagtggtacatcgtgcatggtgtctggacctgagggccgtgagctcacaca
cacagacttgcactctcgccgcccccccaccctctgtcttttttctctcttttctcccca
tccttttcccttctttatatatatatatctatatataaataattttttttttttttgaga
EXON 8  1022 bp
gcatctgttggctgaccatctgctaaccagtcgctcctgtttctgctctgatacttccca
aggcatcccgaagcacctgtcttagctgccccttcctgtcccacagaggatttggcactt
ggttttgacaggatactttaccagctttgatgttaattctccttcccttgtctcctgtag
GGTCCAGCCACAGCAGGCCCGGCGTCCCGGTGGAAGGCAGCCCTGGGCGGAACCCAGGCG
TTTAACGGCTCACTAGGCAGCCCCAGATCTGGGGAACAGATGAGCACGTGGGGAGCTGGA
GTGAGCTGAGCAGAAGTTTTGTGCCCGCCTGCCCCCATCCCCTCCAGGCCACGTTTTAGA
TGGCCCTTGTAGTTGCGGGTCCTGGGTGTCCTCAGAACTAGACATCAATGCCTGGATCCT
TCAGCCGGCCCTGCCCTCCTTTAGGAGACAGGAGTCACCAGGGCACAGCCCTCCAGGCCC
GCCTCAGGAAGGAATGAAAGGAATGCCATCATCTCTAGTTCCCAGGGCCCAGCCTTCCCC
TTCTCCCCCGGGGCAGGGACAGTGCGGCATATTCAGATTCAGACCTCTTTGGGCTGAGCC
ACCTTGTGAGTGCAGTTACTGCCTTTGTGTGGCCGTGACCTCTATTTGTTTGCTTTTAAT
TTGCCAACCTATCGCTGCTGGCAGCACTTTTTGAGCAAGCCGAGAGCACCCATTTTGGCT
GGGGGTTCAGATCGATGGCCTTGTCCATGTTGTCCTTTCTGGCTTCCCTGATGGTGTCAT
GTTTCAGCGCATGCGCCCCAGCCTTTCCCATGTGCCAAACCAGAAGCTCCACTGCCCGTA
GGCTGTCCCTGTAGCCCTGCTCCCTCCCTGGAGGCTGCTCTTCTGATTCTGAGAGCTGGC
CTAGTGGTGCTGAGGGCCCCTTTCTGCTTCTCTGCCCACCTGCTGAGTTGCCACTCGCAG
TGTTGTCAGTTCCCGTGTTCTGAGAAGAGGTCATGCCTGGGAGGAAGGGATCGTCATGCT
GCATCGAATCCTCTCTCCGCCGTGTGGCCCCCAGGAGAGTAGCTGCCTGTTGCACCTGCT
CCACACCTCCCCACAGCCTCCCTGCAGGTGCTGTGTGGCCGTGATGTGCAGAGAGCAGTG
AGGGAGGGTTCATGAACCAGGTGGATCCTCTTTAAAAAAAAAAAAGTTTTTGTTATATCT
CT
agaacatttcaagtcttttcctttttttctgttcctagctatggggttttagagaagtgg
gaacaggaaggcatttgtctttttcttctagtttactacattttccttccgtagttcttc
agctgtgtggaaacgggcatcacaaggacataggatcatagattgggtagggagggagga