Gene CCL20 Variant 1
DNA : 3.68 KbNT_005403
mRNA : 800 bp NM_004591
CDS : 291 bp NP_004582
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  134 bp
cttcgcaccttcccaatatgaggaaaaagcaggaagttttccttgcgggttttttttatg
atgacatgatggggccagttgatcaatggggaaaaccccatgtggcaacacgccttctgt
gtacattcccaatatttgctataaatagggccatcccaggctgctgtcagaatataacag
CACTCCCAAAGAACTGGGTACTCAACACTGAGCAGATCTGTTCTTTGAGCTAAAAACCAT
GTGCTGTACCAAGAGTTTGCTCCTGGCTGCTTTGATGTCAGTGCTGCTACTCCACCTCTG
CGGCGAATCAGAAG
gtaagtgtcgctctttccgctagcacagaagaaagactattttcattttccttttagcct
tgagctcaactgggggtccctaagggatggaaaactgttaggaagtatacaagaggtagt
gatggaagttgtctgcccatggtggagtggaggagagaagagttactgctgcggatcagg
EXON 2  115 bp
ttggttctcaacgaccttacaaaggtttccaagacattgaaactcctcctctaagtggtt
tattcgtcatatacatgagattcactagatttttcacaacttaaggtagttttataatac
caatcacaggataagtttattcatgtggatccaatacctttcacttttttttttttttag
CAGCAAGCAACTTTGACTGCTGTCTTGGATACACAGACCGTATTCTTCATCCTAAATTTA
TTGTGGGCTTCACACGGCAGCTGGCCAATGAAGGCTGTGACATCAATGCTATCAT
gtaagttattaattgattttaattcagttgtatcaggaatacctagaaacttcagtttta
aaaatgtttgcctttttagagtttcattcagaaattactgatgttttgaacataagatct
tattttaaagagaaagaaatgatgtggcaaagatagctttgtcttagtacatatctactt
EXON 3  78 bp
gagaatcactttgattttgcattaatcttcatcagaagcattttttgtgcattttatttt
acctcatcaactgaaatgtttagtgtgtaatcaactggaatataaaatttccattgtatg
ttctatgaaaaacccattgaaaagctcattaaacacaaatcaaattttctgatttttcag
CTTTCACACAAAGAAAAAGTTGTCTGTGTGCGCAAATCCAAAACAGACTTGGGTGAAATA
TATTGTGCGTCTCCTCAG
gtatgttacactgacatttagcctttgcaaatgtttgaggaaagaggagtgtgcaaaggg
gtgggccgtaggttttctgggattctttagtttaactattgtggaatttttaaagggaaa
atttgagttggaccacaaaaacaaagaatgcatttttccacttacagatcatcatcgtta
EXON 4  473 bp
tgagttaggttgggcaagggccatcctctctaaacctcaatttcctcatctgaactctga
gctgcttgacatactgagttgagattaagggcaggtgaagcaacctttaggtaccaaagt
cattcccaccatgcagtcaccttgtcattacttacacttttcttctttttcattttacag
TAAAAAAGTCAAGAACATGTAAAAACTGTGGCTTTTCTGGAATGGAATTGGACATAGCCC
AAGAACAGAAAGAACCTTGCTGGGGTTGGAGGTTTCACTTGCACATCATGGAGGGTTTAG
TGCTTATCTAATTTGTGCCTCACTGGACTTGTCCAATTAATGAAGTTGATTCATATTGCA
TCATAGTTTGCTTTGTTTAAGCATCACATTAAAGTTAAACTGTATTTTATGTTATTTATA
GCTGTAGGTTTTCTGTGTTTAGCTATTTAATACTAATTTTCCATAAGCTATTTTGGTTTA
GTGCAAAGTATAAAATTATATTTGGGGGGGAATAAGATTATATGGACTTTCTTGCAAGCA
ACAAGCTATTTTTTAAAAAAAACTATTTAACATTCTTTTGTTTATATTGTTTTGTCTCCT
AAATTGTTGTAATTGCATTATAAAATAAGAAAAATATTAATAAGACAAATATT
gaaaataaagaaacaaaaagttcttctgttgattgagttttatatcatttttatgatgtg
tattgaaaccatttccaggcacagaaaatataagaattttctgagaaattatatcctcca
cttacttctagttgttccctttatctcggcccctcatggccctggacttgattttacatg