Gene CAPN14 Variant 1
DNA : 44.89 KbNT_022184
mRNA : 2198 bp XM_351429
CDS : 2088 bp XP_351430
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  58 bp
ctaaagaaataattggatttgtgtaatccagtcgcaaagccctgggtactccactccctt
ccagagaacacacagtggggaggaaccaaggtcctgggaggtggggtcgcaaattcttgg
ctaaacaccatgtgtagaaaggacccatatataagaggtggtttcaggctgcatgcttct
GACTGCACCGGGATTAGAGCTTGCCCAGGCGCTTAAAGAAGCAAAATCTCCTGTGCAG
gtaaatttctttagttccaagggtgggtccaagttagcccagaggccctatgagactcta
cagggtctgggtttagaaggtgagaggatggtatttgcttctcctggtttgagctttgca
ggtgagtgtatacagaaaaaaccctggagtctggagatttcaattttgtcctcagttttg
EXON 2  277 bp
cacttgagtgagtgctcaaggacccacactctctgggacaaaatcgaaccacctgcttct
gtctctttctcaccagctgacttctccgctcccattctctccatccttcccctcgtctct
gtggcaatggcaaagcacaaggaggaagtgaggaaactgaccgtcctctctccatttcag
GAGCAGCAGAGACTCCTCAGGAAGACTCACTGGACTGTACCCACCACCTGCCATGTCTCT
GTGGCCACCTTTCCGATGCAGATGGAAGCTGGCGCCAAGGTACTCTAGGAGGGCGTCTCC
ACAGCAACCCCAACAGGACTTTGAGGCCCTGCTGGCAGAGTGCCTGAGGAATGGCTGCCT
CTTTGAAGACACCAGCTTCCCGGCCACCCTGAGCTCCATCGGCAGTGGCTCCCTGCTGCA
GAAGCTGCCACCCCGCCTGCAGTGGAAGAGGCCCCCG
gtgaggcaaaatgtgtcagcccagaccctccttccccagggtttagggctttcagatact
gcgcctaagatatatgggagaaaaaaacaggctttttcctactctctcctctccactcaa
cacaacacactcttctaacaccagatgtgtaggaggttttccccacatgccaagcaattc
EXON 3  70 bp
tgagaaatacaaaggacagaattctgtatcccagatcttctgggatagcactgattacac
ctatattctgtatctttgtccccataagtacagttttggggtatgggaaaacgtggtcac
tgtagctccaggagcttttttgttctaggtcagaatgacaattctgtttgtctttcccag
GAGCTGCACAGCAATCCCCAGTTTTATTTTGCCAAGGCCAAAAGGCTGGATCTGTGCCAG
GGGATAGTAG
gtaagtttgcacagccccgagagacagacactaggctgcctgctgaccaggcctggccaa
gacagagtggttgataaagaagagaagccagagatccccactggagagaggcccaaaatg
gctattcactggcaaaacgctacctggacatgttctgttctttgccgtgaagtttataaa
EXON 4  119 bp
atttcagccaatgctcccagccccacctctgctcactcatcatccgccttcccagtatat
aattcccttctcctaaactgggctacaagcccagagagggtggccattgggaccgggcat
tttctgcagtcataaagtccccagtagattcatgcagatgctgtgtgctgtctgacttag
GAGACTGCTGGTTCTTGGCTGCTTTGCAAGCTCTGGCCTTGCACCAGGACATCCTGAGCC
GGGTTGTTCCCCTGAATCAGAGTTTCACTGAGAAGTATGCTGGCATCTTCCGGTTCTGG
gtgagtgtcttcccgggtcctcagcccagagggagtcataggaaaaagggttcctggagg
accatgtcttcaccttctgggctgatcaccatctgcagcagtcctcattcacccggggcc
actctctccctccagttctggcactatgggaactgggttcctgtggtgatcgatgaccgt
EXON 5  137 bp
aatcagagtttcactgagaagtatgctggcatcttccggttctgggtgagtgtcttcccg
ggtcctcagcccagagggagtcataggaaaaagggttcctggaggaccatgtcttcacct
tctgggctgatcaccatctgcagcagtcctcattcacccggggccactctctccctccag
TTCTGGCACTATGGGAACTGGGTTCCTGTGGTGATCGATGACCGTCTGCCTGTGAATGAG
GCTGGCCAGCTGGTCTTTGTCTCCTCCACCTATAAGAACTTGTTCTGGGGAGCACTTCTG
GAAAAGGCCTATGCCAA
gtaagaaaccggcagaaatatcccccttcccatcgcttctttttctctctctcaatgttg
agggaggggagtggagtcaggtaaagtttatgaaatgagatcctgaggcatgtcttagcc
aacatagaagtgacaacgtattcagtcttttatgtaggggtcacctcatctaaacctgca
EXON 6  175 bp
gaccaccagctggagccattcaggatgggtatggtattggaaactatgtcagggttgcct
gagctctgcttttggtatgagaaaactagactcctatttaaaagtggatgccgaggccac
ataaaattataaatactcatgatacttttttcctctcatgtttatttcttccctggccag
GCTCTCTGGTTCCTATGAAGACTTGCAGTCAGGACAGGTGTCTGAAGCCCTTGTAGACTT
CACTGGAGGGGTGACAATGACCATCAACCTGGCAGAAGCCCATGGCAACCTCTGGGACAT
CCTCATCGAAGCCACCTACAACAGAACCCTCATTGGCTGCCAGACCCACTCAGGG
gtgagactgggctgccactggcagaatgtcctcttctcctgcacccatgccctccatcca
ccaccactaccctcacctgggtgtgggctcagggcctccacccagctcctagtgctgagg
tcctggtgttcaaaccagagcagcaaggccaggtgcggtggctcacacctgtaatcccag
EXON 7  63 bp
tgagagggtggaatgagactatggataccaaagagctttgaaaactgcaatgtaccatac
catgattatctcccacacttctctccataaacccctgctccagccaaacagccttcccac
gactcaaagaataagctgtacataacagaagactgatcaggacctctcttgtctctgcag
GAGAAGATTCTGGAGAATGGGCTGGTGGAAGGCCATGCCTATACTCTCACAGGAATCAGG
AAG
gtgggttgaggttggcccttcggtttccctctcagccttgcccttccctctctggaccct
agcttatcttggtggatttagtttctgtaccatctggagagtgggtaaagtctttggtgg
gtccctgtgcctcggcatctatttcctgcggtgaagtggtgggtccaggctttgccacca
EXON 8  86 bp
atttgccctaggtctcacagcttgtaagtacaagaagcagagccactttctcctctacca
gctctctctggggctgtgattttccactgcaagtgctcagctccaggcccgagtctcact
cagatctctggaatgtttgcactcagcccagtcacctaaactgcctctcattttatgcag
GTGACCTGCAAACATAGACCTGAATATCTCGTCAAGCTACGGAACCCCTGGGGAAAGGTG
GAATGGAAAGGAGACTGGAGTGACAG
gtgaactttggggacatcttggaggggtgagaacaggtaggttaggcaaaggaggctgcc
atttgcacacagattcaaatgtgtgctttctttggtcttaggctggatcaggaagccttt
agacggggaagctcaatccctcacatttagaagatgctttatggtatagagactgctttc
EXON 9  164 bp
cagggatctagccagccccagctgatgtgcctatcgtcagctcagctctgcacaagagct
ggtgtctttgtccatgagagggctgggatgcccactgctccgtttcaccctccccatggg
tcctgataactaggcgttatctggtccatctctttgtgcttttccttcttctctccacag
GATGACGCTGCAGGACTTTAAAACACATTTCGTGCTCCTGGTTATCTGTAAACTGACCCC
AGGCCTGTTGAGCCAGGAGGCGGCCCAGAAGTGGACGTACACCATGCGGGAGGGGAGATG
GGAGAAGCGGAGCACAGCTGGTGGCCAGAGGCAGTTGCTGCAGG
gtgagcatgtgcacaggagcagggctctcagggtgaggttgtgggcgggggtgtcagaat
gactgcacagggggttgcagcacgaattctgcattggctgagtggggaggaggctctgct
tgcctcactgtgtgttggggccctgggctataaccacagggaagatggggtacctttgga
EXON 10  164 bp
tggaagagcaaggtgggagggcgtaaatccaaggttgaagggaccccgactctgtcccag
tgggcctcagggtgtcaatcctggcagaggcgtcctcagactgttcacctcttagtggtt
cggcaagcaggatgcatggggatccggggcccattctcaccttgctgtgttctgctccag
ACACATTTTGGAAGAACCCGCAGTTCCTGCTGTCTGTCTGGAGGCCCGAGGAGGGCAGGA
GATCCCTGAGGCCCTGCAGCGTGCTGGTGTCCCTGCTCCAGAAGCCCAGGCACAGGTGCC
GCAAGCGGAAGCCTCTCCTCGCCATTGGCTTCTACCTGTATAGG
gtaggtggacctctgaaccacaggggcatgggaccaagcgtgggggtcaccaacagttac
catgtcttcctgtttcctgtcttcttcaccatctgtctctgttcacagacctgggttttc
aaatccaggctctgtcctttaggaacatgtgatttagaacaagtcaccttcttgcactag
EXON 11  206 bp
ctccacacacatattctggtttttcctttcctccccacttgtttcatcctccactggggc
ctattggatttggcagagcagaggccaccttagtcctggctcagagctttgagggcctca
ggcctggccacagccctgggtcatcacctcccttgctgttcttctgtcctctacccacag
TACCATGATGACCAGAGGAGACTGCCCCCTGAGTTCTTCCAGAGAAACACTCCTCTGAGC
CAGCCTGATAGGTTTCTCAAGGAGAAAGAAGTGAGTCAGGAGCTGTGTCTGGAACCAGGG
ACGTACCTCATCGTGCCCTGCATATTGGAGGCCCACCAGAAGTCAGAGTTCGTCCTCAGG
GTCTTCTCCAGGAAGCACATCTTTTA
gtaaggacacaaggtctctcctagagggtggggaccacttggacgaggacaggcaaggag
ggcaaggttggaaatggcagaaaccaggatctctgctgctgagacaaaagggagatgggg
agagcaggagaccaggtgactttctgcatggagaacatccctcccgttccttcccaccct
EXON 12  37 bp
gtgcacatggctggaatgtacagttcaaggggaagcaggaggtgaggtgtgagagctggg
tgggcccttgtggtgcctcagtgaaggaacgtggaagacgagctcccaggagaaggggaa
gattggccaaaaaattcccaagaggaaactctgagtttgttcttgtttgtttgttctcag
TGAAATTGGCAGCAATTCTGGTGTCGTCTTCTCAAAG
gtgagtagtctggtggaattccatatggctgggactgctttccaagccagggtgttgggt
ttctcccttcaagttaaggagtcaggggaggagatatgcggatccttacagaccctgttc
tatggcaaacattacccgttgtatcctaacagtacctgggctttgctgtttttgcaccaa
EXON 13  57 bp
gagtcaggaaaaattggagaagcaagggctgtttgtaaatgctatggtgtaaaattaaag
acgatgcaaagtcaagctcatggatttcagaaacctggaagccatgagacattagggtgt
gcacgaaagtccgtttatacaggtgaataattgtgtctttctgtgtgtctcttcctatag
GAGATAGAAGACCAAAATGAAAGGCAGGATGAATTCTTCACCAAATTCTTTGAAAAG
gttagttgaacaggtgtggtggggggtgaggaagagcaggggacgaagtggagcttctca
ttttataaagtataggtttgcacctgcttgaggctgcttagaaactgtgatttaaggcta
cctattgcccaaactgccactttctattaaagtcctcaagtttttagacaaatgagtgga
EXON 14  195 bp
tgggagtttgactctatgatcctggccctccctaggtacaaagggcatgttcatttggcc
ctctgtgtaagcaaacccaagccgtaccaggcatcccctatagcatttgactttctccat
gggtaggaacgaccgtcacccccccgtctctctactgtcttccattctcactcttcccag
CCCACGTACATACATGGTGGTCATCAGCTGGCCCATGCAGCACTGCCTCTTCCTGCTCAG
AAAAGGGGTGTGCAGACCTGGGGCCAGCCCCCATGTGGACTCTTTCGCTCCTTCACAGGT
CTGGGGAGCAGACAGCCCTTCTTTAGCCTGGAAGCCTGCCAGGGGATCCTGGCCTTACTG
GACGTATCCTTTCAG
gtttgtgggtggatgcttgctgttggttgagagcttcactctggagctaggcagagtata
tttgaatcccaaccccaatccttgctaattgtgggatcctggacaagccactgagcctca
ttatgtatccagatgctcatctgaagcatggagagagtgttgaaacttacttggtaggat
EXON 15  69 bp
agtgagggagccctgggctggactggccagtgaggtgaggcgaactagcgaaatcagaca
tgatcagacattgaatgaggccatccacaaattgcacatcactttgtggagggctgatca
ctgcctccaaagcatggatagaactctccctggaagcttttaccttaacctattaatcag
CTTAATGCATCAGGTACTATGAGCATCCAGGAATTCAGGGACCTGTGGAAGCAGCTGAAG
CTCTCTCAG
gtaagaacaagtcttaaccacacctctttggaagatggtgtaggaatggcagttctgcaa
agctgtagaagatacttctgtccccttcagccctttatatccacctcaccaaaccttctc
tattctcccttcggtgagcatttcctctattggtctcttccaaactcagagagctggttg
EXON 16  76 bp
atgaggcggtaggatcccagcatggactctgccatattcttatcctggcaacaggccctg
catgtggagcctcagatatcttcaacagcccctctgcggtgctgacaaggggcacacagg
gctctcagatggtgcttggaaatgcctggcttcctgaacctcttatttggttctttgcag
AAGGTTTTCCACAAGCAAGACCGTGGGTCAGGATACCTGAACTGGGAGCAGCTGCACGCT
GCCATGAGGGAGGCAG
gtaggcacaggaagagctggagctgtgggcacacacgggcagggtgcacactcatcaggc
agaggagaggggatgtgtggcatgctgaagtaactctaatacgcagtgttactctcaaag
acgtagatctgcagtcaactccaacattttttatgattgtccctgtgatcctagccaaca
EXON 17  117 bp
attaaataaaataaattggttaaacaattaaaccattcaaaatgaaccctataaaagaag
atttccatgctatcaggattcaggtccctaaactggagggacatttgaaggggccttgag
caggaggggagctgggtgcaagcccccaatacccacagcaggagcttgtgctcaatgcag
GAATCATGCTCAGTGATGACGTCTGTCAGCTGATGCTCATCCGCTACGGCGGCCCCCGCC
TCCAGATGGACTTTGTCAGTTTCATCCACTTGATGCTGCGTGTAGAGAACATGGAGG
gtaagctggcgggaagctggggagggccaggtcttcctctgctgccccatgacttcccac
ctgtccctagtttaagcacaagggaggacagccgccatcccagaaacagcagaccaggga
agctgtggggacctccagccaagtgcctgtgaaccctggctgcagatatccaaactcatc
EXON 18  56 bp
aaaggcttgaagtggctcacttatcatagatgtggctgcgtgtggtcacatgtaggctga
cactgggttccctcacgttttcagaatggatgtggttaaggtgagacatatgggaggaac
taattcataatgtttccaatagacacattagctgtattcctttctgctgcattttcacag
ATGTCTTCCAAAACTTAACCCAAGATGGCAAAGGGATATACCTCCAGAAGCCAGAG
gtaagacttgccccaaggaggtggctcatgtcatcttacgtagaggtggcccttgcggga
ccatgctcttgtgaaggagaagggctctggggacactttattctgctgaattggaaattg
agcactacattcattgcactcattcattcattcattcattcacccatcaaatattttctg
EXON 19  72 bp
ggtgctagcctcactctcctgagtctaggtatctgcactgtggcaactcaaagatgacct
gtctttgctgacacccttcctccagattctctcctatacccccaaagctgagtactgaag
accagggggcagagcaatctccccactcccaccacgcttccccatcttctgtcactccag
GGGAAGCAGGGGCGGGAAAATAGAGATCTGGGGCAGGAGAAACTGGGCAAGCACCAGGGT
GAAGTCAGCTGA
agggctgagagttgaccatcagcagttctggaatatcgaaagcagaaagtctgccatgaa
taagaaaaagtggaaagtgcagccaaggaggagtgagaaatcacctgccagtgccaagga
gggtgaggtcaaggaatccagaggttgggttgtcaagtccagcccacgcagggaaagcat