Gene C1D Variant 2
DNA : 20.79 KbNT_022184
mRNA : 1172 bp NM_006333
CDS : 852 bp NP_006324
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  54 bp
gtagacaaaagttccgagtgccgccgcaatcgtctcccacaacatgggtctgagctactc
aaaatgagatttgcctttggagaagagttaaggagcagggggcgtggcgagcagcgtgag
atcatcgggaagcgccgctcgtggcgggggcagagccggcgcgtcattgtcgtcatcgtt
GCCCGACCGCTTTCCGGGAGACTGGAGTCGAAGGCCGTGAGGTATTTTTCTAAG
gtgtagtttcagtttttctcctgctcctgtttaactccgcttttcctctcctgggattcc
cctgtcatcctctgggcagactgagaaaatcggagtttggctgcgtagccttccaggaat
gcagtctctcacagctcttcgttggggcagcattgttggcaggtcccccacttccgcttg
EXON 2  147 bp
ttaagaaggggacaaattggaatgtagttaatctagaattaaattttaaaaagatttgtc
ttcaggttttaactcttagtgcctttgaaatacatgatatgacctattgatttttttttt
tggaaactaaagaacaagctctgtctctaatatgaattcaaagaatttaattttttccag
TCAGCCATAATGGCAGGTGAAGAAATTAATGAAGACTATCCAGTAGAAATTCACGAGTAT
TTGTCAGCGTTTGAGAATTCCATTGGTGCTGTGGATGAGATGCTGAAGACCATGATGTCT
GTTTCTAGAAATGAGTTGTTGCAGAAG
gtattttaaaaatgtaatttcctaaaaatgaatttcataaaacagaatgctattttatga
aacatgtggaagaagaaacagattaatgacctatgccccttttcccctttatttcaattt
tattagtgtttgggtatttttaggggggaaacaaaacaaaagaaaactccagccttagga
EXON 3  67 bp
aaaacttctttttacaaattattttcagatcatttggttattggattatatgaagtgaaa
aaaacttctttgatacattgtacttggtaaaagtcaaatgttatcagatggtgttcaaag
tttgtgtattttttttctgtctcactttctctctttccctctctctttcttttttaacag
TTGGATCCACTTGAACAAGCAAAAGTGGATTTGGTTTCTGCATACACATTAAATTCAATG
TTTTGGG
gtatgtgtgttactttggaattaattagaaagcaaattacttattgtgtgaaagatgatt
tatttttaaaatgctaacaatttatttacaattatactttataacacttttaatagatac
ttatttttaaatctagatgccagtgagccacacatagatttagtattacatggaaattga
EXON 4  56 bp
ttatttttaaatctagatgccagtgagccacacatagatttagtattacatggaaattga
ataatttaaagtttaattgtttgtaggactttccttttttgtgaataactagtttcttta
attggaatgttttaaattaatacattcaccattttattccatgaaatttttctcttgtag
TTTATTTGGCAACCCAAGGAGTTAATCCTAAGGAACATCCAGTAAAACAGGAATTG
gtaagattttaatttctttttattttatgtgtttgttgttgtattcctgaggtttgtcac
actacctttgtcacacaaattagggagaacagaattcgagttgaaattatgaaagtgagc
cagaccttattatctttgggtttttttttctcttacctttttcagataattggtattcca
EXON 5  848 bp
ctatgaactccaggcaagcagggagcgtatttatcctattcatttgcatttcctagcacc
atgcactttaataggcaataaatacatatatgttgaatttaaccaaggtgtacagtataa
taaaattcagtggtggcgaatagcttagtaaatctattgcctttgttttttatctttaag
GAAAGAATCAGAGTATATATGAACAGAGTCAAGGAAATAACAGACAAGAAAAAGGCTGGC
AAGCTGGACAGAGGTGCAGCTTCAAGATTTGTAAAAAATGCCCTCTGGGAACCAAAATCG
AAAAATGCATCAAAAGTTGCCAATAAAGGAAAAAGTAAAAGTTAACTTTTTGGTTTTGAT
GTACACATATTCAAAAAGTACATCTTCCCCCCCCCCCCCCCCCCCGCAAAATAATTCTGT
GGCAGGGCAAGGTTTAAATGTGTTTCTTATTAATATGTAAATTCACAGTAAATATGTAAA
GCTAAATACTTTCCTCTCCAAAGATCATTATCTTTATTGATTAGCACTGAGGATTTTAAC
ATTGTGATATATTATATATTTATAATTTACCATCTCTTGATGAGACTCTTATTTCTTTAT
ATAGGTCAGTCTTGCAAGTACCATTTTATAAGCAGCTGTGAAATTTAAGTGAAATGTTCT
TTGTAAACATTTGTACTATTTTAAATGAATAATGACCTTATGAAGTATGCTATCTGTAGG
CTGAAATTATAGGTACATCTGTTTTCACTATATGATATTAAGAAAGCGTGAAATGACTTA
AATGTTCATTTTTTTCTGTATAGATACTTTATCATGTTTTCATGATTTTAGGAATTACTG
CTTTGTTGATATTCAAAGTGTGAAACTAAAACTTTATGGTTGTACTTTAATTCTTGGCAT
GTTGCCTCTATGTCCCATTTAAAATAAAATACATTCTCATTAACTTTAGATGGGAAATAA
GGTTGTATGTTGATGGATGAATTTTGGCATGATGACTGTACTCTCAATAAAGGCTGAAAA
TGTTGTAT
aactgacctgtgtatttttatcttttgagtaaatttgccttccaaattaggaagataggt
tttagaagtcatcacaaatagagaaattcttgagtttttgttcctgatgcatggtgtcca
cagttcttttcatctcattttttttcagattttttttatttcatgtttttgaggctgtat