Gene BARD1 Variant 1
DNA : 81.09 KbNT_005403
mRNA : 2530 bp NM_000465
CDS : 2334 bp NP_000456
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  231 bp
ctaggtcccgcccactcggccagcggctggctctcgcggccccgcccctgtgccctgcga
gtccctattttgggagcattgcggccgccgtgccccgcccctccccgcgcgccccgcccc
tctggcggcccgccgtcccagacgcgggaagagcttggccggtttcgagtcgctggcctg
CAGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATC
CGAAGGCGGGACGATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTC
CGGGAACGAGCCTCGTTCCGCGCCCGCCATGGAACCGGATGGTCGCGGTGCCTGGGCCCA
CAGTCGCGCCGCGCTCGACCGCCTGGAGAAGCTGCTGCGCTGCTCGCGTTG
gtaaagacggagcttcttgggggtggctgcgagggcacgggtcgcacagtttctgggggc
ggcagaatcttttcaaatcttccgtttcctccttccgttcccgcgctgcagtcgggtcgg
cgtgcggttagcacctgccgggggatatagtattaacaacttctgcttctcattcacttt
EXON 2  57 bp
gtatgttatggtacaatatttaaccagggagtaacagcctttcaaatgaatgcatcctta
ataccttctgctttgagaaagtgagaaatatggtagtgttgggccttggatgaaatattg
ggtgtgagatgtttatctaacaatgactcaaatcttgattgttttaatttcttcaaacag
TACTAACATTCTGAGAGAGCCTGTGTGTTTAGGAGGATGTGAGCACATCTTCTGTAG
gtaagtaattacggtttgatgtatatagtacaactgtattttttactagataacaatcat
gtaatcttgttgataataatggtacttgatgtttgtgtaactttcaaagtctgcaaagta
acctattgtacattatcttagtttgatctttaaaactgtgtcttaatttacaaataagaa
EXON 3  149 bp
aaccttagatttgatgtatgtattttactctttaaaacagtattcaacaaggatattaca
attgaccattgtatgttagaataacctctgctccatttatttctgttcaaactgtttagt
ttttggaattaaattctgctgaatgggttgcttttttttttttttttaattattttaaag
TAATTGTGTAAGTGACTGCATTGGAACTGGATGTCCAGTGTGTTACACCCCGGCCTGGAT
ACAAGACTTGAAGATAAATAGACAACTGGACAGCATGATTCAACTTTGTAGTAAGCTTCG
AAATTTGCTACATGACAATGAGCTGTCAG
gtaagaactatccctatctctcttagttaaattcatcagttaaaaactgatgaattcata
ttcataaagtatataaaacatctatctggagttctggaatacgtatttcagattttaaaa
tctgtaggttttttttttttttttttaaatagccattgagtctctctatgttgtccaagc
EXON 4  950 bp
cagtaagtattgaatgagtgaatatctgctatcaaagagttcacactctaggagctgaga
aagaagtacataattaaaagatgatacactttaggggaactgtaaacaaaattcttcggg
agctccatgtgggagcaataaatttcatgtaacagatttctttttctttttttctgtcag
ATTTGAAAGAAGATAAACCTAGGAAAAGTTTGTTTAATGATGCAGGAAACAAGAAGAATT
CAATTAAAATGTGGTTTAGCCCTCGAAGTAAGAAAGTCAGATATGTTGTGAGTAAAGCTT
CAGTGCAAACCCAGCCTGCAATAAAAAAAGATGCAAGTGCTCAGCAAGACTCATATGAAT
TTGTTTCCCCAAGTCCTCCTGCAGATGTTTCTGAGAGGGCTAAAAAGGCTTCTGCAAGAT
CTGGAAAAAAGCAAAAAAAGAAAACTTTAGCTGAAATCAACCAAAAATGGAATTTAGAGG
CAGAAAAAGAAGATGGTGAATTTGACTCCAAAGAGGAATCTAAGCAAAAGCTGGTATCCT
TCTGTAGCCAACCATCTGTTATCTCCAGTCCTCAGATAAATGGTGAAATAGACTTACTAG
CAAGTGGCTCCTTGACAGAATCTGAATGTTTTGGAAGTTTAACTGAAGTCTCTTTACCAT
TGGCTGAGCAAATAGAGTCTCCAGACACTAAGAGCAGGAATGAAGTAGTGACTCCTGAGA
AGGTCTGCAAAAATTATCTTACATCTAAGAAATCTTTGCCATTAGAAAATAATGGAAAAC
GTGGCCATCACAATAGACTTTCCAGTCCCATTTCTAAGAGATGTAGAACCAGCATTCTGA
GCACCAGTGGAGATTTTGTTAAGCAAACGGTGCCCTCAGAAAATATACCATTGCCTGAAT
GTTCTTCACCACCTTCATGCAAACGTAAAGTTGGTGGTACATCAGGGAGGAAAAACAGTA
ACATGTCCGATGAATTCATTAGTCTTTCACCAGGTACACCACCTTCTACATTAAGTAGTT
CAAGTTACAGGCGAGTGATGTCTAGTCCCTCAGCAATGAAGCTGTTGCCCAATATGGCTG
TGAAAAGAAATCATAGAGGAGAGACTTTGCTCCATATTGCTTCTATTAAG
gtaggatgcttactctgaaataccatctcagaatgaggccaactataaagcaatttcttt
gcagtttttgaaaaatggcataggattactaggataattaacctttcacagacatgatac
ttcctctgaaccagagaagccagattcatagggagagcatctctacttcagttggagcag
EXON 5  81 bp
tgggattacaggcgtgagccaccacacccggcctaataatttattaactcatgaacagta
gccttaagagaaaacgatttaagttttactttatattgaagaaggcagcatttaaaaaag
ctcaatattttcctttctttccttaatgctttttaatttccgttttgttcatttttctag
GGCGACATACCTTCTGTTGAATACCTTTTACAAAATGGAAGTGATCCAAATGTTAAAGAC
CATGCTGGATGGACACCATTG
gtagttgtctggtttttattctcattctttctgtgttttacagttcttatagtttatagt
tatgtagttgtctatatatcatcctctgccacatatactctttttagtctgaagaactta
tgttttcatcaagtatgagaacatgattactttccttctagcttttcatttgtgacaggc
EXON 6  173 bp
tgaaagattattaatagtaactttcactctgtcagcaacttatagtgtttttgagtattt
aggtaacaataaatttactgcctgacgtttacatttatttttctaaagtgtgatattata
atatcatccattgctctttcttatcacttctttcacttctttttcaaaaaatttaattag
CATGAAGCTTGCAATCATGGGCACCTGAAGGTAGTGGAATTATTGCTCCAGCATAAGGCA
TTGGTGAACACCACCGGGTATCAAAATGACTCACCACTTCACGATGCAGCCAAGAATGGG
CATGTGGATATAGTCAAGCTGTTACTTTCCTATGGAGCCTCCAGAAATGCTGT
gtaagtagttcaacgtaaaaattatttttaaaatggacctatattcttgaatcaaggtgt
gtgataaagcagactttaaaatagtcaagttgatggctttcttcactttcacaactaaaa
ttagatgtgatcatcacattctgcactcataatcagccttcatgccctttttatgataca
EXON 7  109 bp
aactgaaattttacatcatttctcctttgagttcagcagcttttgattctagattcttct
gcctaatatgagttctgagtaatttattttagttaaaattgtatattattaaggatgttg
aaaaattgagtcgagtcacacatttgacttacttaaacacatctgcacttattttaccag
TAATATATTTGGTCTGCGGCCTGTCGATTATACAGATGATGAAAGTATGAAATCGCTATT
GCTGCTACCAGAGAAGAATGAATCATCCTCAGCTAGCCACTGCTCAGTA
gtaagtatggatttagctttgggacatttatatattttattaaaattggttatgaaagga
acataatagaaaaatttccatttgaccaattgcttacattcaccaaacaattattgagca
cttcctgagtattagctactgtggattcaaagacataatcacagtacgaccatctagaaa
EXON 8  133 bp
aaaaataaagagaaaaaatttatttaaaaggttctgggtgtagattcaatggaaataatt
gaaaattattagagtaaactaagtaatgaaattcaagcttatatcaagtaacagtctgtt
taatgtctttgtctagtcgtctaatgtttttaacactggtatctccttttatattaacag
ATGAACACTGGGCAGCGTAGGGATGGACCTCTTGTACTTATAGGCAGTGGGCTGTCTTCA
GAACAACAGAAAATGCTCAGTGAGCTTGCAGTAATTCTTAAGGCTAAAAAATATACTGAG
TTTGACAGTACAG
gtgaggattttgaattttgggaggtggggtagaaaaaatgttaaatagatgatccttttg
gagaactacctttgataatttacatatgttttaaccattgggagatggctgtatactttg
catcttgtaatacatctaaattttttttcagtaataaactacttatagacaacaacgtag
EXON 9  93 bp
tgatggccaggttagagaactagatactaaatagaagtagtcttacacttaagtgtaaaa
attgttgcctttgaagattcagatataagcttacaaaatatagatgagttataagaagca
ggccaaagaaatactttggcttgtatctttctttctcttactgctttttttgtattttag
TAACTCATGTTGTTGTTCCTGGTGATGCAGTTCAAAGTACCTTGAAGTGTATGCTTGGGA
TTCTCAATGGATGCTGGATTCTAAAATTTGAAT
gtaagtgttggatttgagagaattaagaaatgaattagactagttttgtttttcatggtt
attaatgcctgtgattaaggaacttgatgttaattttcttacctctggttagtcactgca
ttttggaaaagcttctggctgggcgtggtggctcaagcctgtaatcccagcactttggga
EXON 10  98 bp
gaaaaccagttgtattacattttgttttggcataagtaagatttctgtttgcattttaga
ataatacttaaaaactgccatgaagaagaaaaaccacttaggtaaattgcttgattttaa
tgagagagatatagtgctcacttgatacttagtttgctttaattcttgtgtttttgtcag
GGGTAAAAGCATGTCTACGAAGAAAAGTATGTGAACAGGAAGAAAAGTATGAAATTCCTG
AAGGTCCACGCAGAAGCAGGCTCAACAGAGAACAGCTG
gtatttttcttttaatacaactttcattgttcttattatgacatactattattatcacca
tcaggaagaacttctgccctttcaacagctacaggtgactgattaaaattttaattgtgc
ttatttcaagcacttgattctgaaagatgatcacgatgagcagtaaaatccagaaggtaa
EXON 11  456 bp
tacctcatgtatatgcaaattttccaaaacccaaaaaatttatgaatctgaaatgcttct
cctccaaatgtttcaggtaagggatattcaacttgtatttttattttcctcattcatata
cagtgtttttgaatacagtattttgatctgcctttaacaaatgttttctcattatttcag
TTGCCAAAGCTGTTTGATGGATGCTACTTCTATTTGTGGGGAACCTTCAAACACCATCCA
AAGGACAACCTTATTAAGCTCGTCACTGCAGGTGGGGGCCAGATCCTCAGTAGAAAGCCC
AAGCCAGACAGTGACGTGACTCAGACCATCAATACAGTCGCATACCATGCGAGACCCGAT
TCTGATCAGCGCTTCTGCACACAGTATATCATCTATGAAGATTTGTGTAATTATCACCCA
GAGAGGGTTCGGCAGGGCAAAGTCTGGAAGGCTCCTTCGAGCTGGTTTATAGACTGTGTG
ATGTCCTTTGAGTTGCTTCCTCTTGACAGCTGAATATTATACCAGATGAACATTTCAAAT
TGAATTTGCACGGTTTGTGAGAGCCCAGTCATTGTACTGTTTTTAATGTTCACATTTTTA
CAAATAGGTAGAGTCATTCATATTTGTCTTTGAATC
aaaaaaaaaaaaaaagtctaatgccagattaggaattcatgttatgtttaccatttagaa
gctgggattgcttttaaaggtttttctttttaaaattggcatgtttttgatttatcatgt
ctttctattcagattattgggtatcaaagattaatgaggacaccagaatcttggttaaat