Gene ATF2 Variant 1
DNA : 93.89 KbNT_005403
mRNA : 2109 bp NM_001880
CDS : 1518 bp NP_001871
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  120 bp
cccgccttcttctccttaagcctgacggaatcacctgactcggaggcgctccctcagaag
gaaggcaagaaggggcgtgtgggtgaaggggaggggcgccagaaggaaggtggggatgcc
gggagcggggcgagcgggcgggggttgtcagtccgatctcgcgagagaggacggaagcct
GTGGGAGCCCGTGGCCTTTAAAGTGCCGTTCAGCCTTTTCCTCCAGGGGTGCTTTGTAAA
CACGGCTGTGCTCAGGGCTCGCGGGTGACCGAAAGGATCATGAACTAGTGACCTGGAAAG

gtgagtaacgatgggcagaggtcagcagggctggagactgtagggatacggagaaagaag
gcgctaacatggcgacgtcgctcagcacagtccccaccccccgtttcccatcacctcggg
tgctcctgacgtgctccttagcccttggggcgattgtggctgtgctgccacctcggcggc
EXON 2  99 bp
ggagggagaaccttaagttttatattgaaaaacatggaatgggaggcaaaatttacatac
atttttgaaatattaagaaaacatttttaaaaattctatggaattgaaatacaagaggct
attaatttagatcccacatggtaataagttcactcttttctgcctctctttttccctaag
GGTACTAGATGGAAACTTGAGAAAGGACTGCTTATTGATAACAGCTAAGGTATTCCTGGA
AGCAGAGTAAATAAAGCTCATGGCCCACCAGCTAGAAAG
gtaagagattttaagcttttaacataaaagtattcttttcattttgtgattatctttcaa
atactaccgaatttagtagatgtttccagacagttgtcttcagaatgctgaagtcctacc
gtattgatagtgtttagtaaaaaaagatgctgagattcagcaaatttggaaatgtctttt
EXON 3  75 bp
gatatttgtgtaggtgtgttgatatttcaagagcagtactctattataaaaattgttaat
agtgactagttttggggtgacagtagtgttacagagagtaatttgagcactttattttct
actgtttcaagaagtgtttcagaactatttttaacagtgtgaaaccactttgtttttcag
TATTCTTGCCATGAGAAAAAGAATGTGATAAGTTATTCAACTTATGAAATTCAAGTTACA
TGTGAATTCTGCCAG
gtatgtgtgcaatatttggtatttttagccattttttacattttgggttgtaaaaatctt
tatagcttgtttctattaggtaagtatttgtggtgtttttttccatacaaaacaagtcac
ttacttagtatgtagtttagctgatactcctattttgtttttaaataatcaaattaaaag
EXON 4  70 bp
gttacatgtattttatctactctcataataagaaagatagaattaaaatgtcagaaaagt
gttttattttgtattaaaatagaaaagttaataagcttaatgaaaaatcttgagatttat
attttaaattattctttattttaaaatatgtactctaaagtgtcttctgtttgattatag
GCAATACAAGGACCTGTGGAATATGAGTGATGACAAACCCTTTCTATGTACTGCGCCTGG
ATGTGGCCAG
gtaatatataaattactttaaattattttgtatatttccacttattaaaacattgatgat
ataatatgttatcactaaaagtattttcttacagtattctgtaaaattttagagttagga
tgaaaaaaaacccaggaaacttttggcaagaaattctgctttttcttcaatagtgcaact
EXON 5  97 bp
ctgtgattgtttgcaatctagtgtgctatctactaacaataacggattcttttatagttt
aaaaactgctatttcactgttaatggtggttttacatgttgtggaaattaatttcctaat
cattttacttatttgatcaaattgaaaatcttaactatattttaaaactttttgccacag
CGTTTTACCAACGAGGATCATTTGGCTGTCCATAAACATAAACATGAGATGACACTGAAA
TTTGGTCCAGCACGTAATGACAGTGTCATTGTGGCTG
gttagtatatgcttttattaatagcttgtatacatatttcacctggaatgtgcacaattt
ttgtgtattctctgtaaataatatagtctggtgatattccaatgacttcattatagtaaa
tgttggcaacatgtattttacccattacattttcatgtttccttctgactattcatttca
EXON 6  119 bp
ggaaatacgaagtacaacaaaaatttaaccaaattttgtttgttttaaaggaagaggtct
ttccaaagagagaattaacaactgactgaaccagtcctgctaatttgttaacttagtagc
tatattttagagtcttaacatatttaaatatgcatgattacttcttgacatttatttcag
ATCAGACCCCAACACCAACAAGATTCTTGAAAAACTGTGAAGAAGTGGGTTTGTTTAATG
AGTTGGCGAGTCCATTTGAGAATGAATTCAAGAAAGCTTCAGAAGATGACATTAAAAAA
gtatgttgtaaccatgaaatttaaaaagagtacttctgacagaaaagtaatcatagttta
tacttcctgctttttaaatttagacacactgtttttgaacttataaccttttccttatta
tttgaattatagatgcctctagatttatcccctcttgcaacacctatcataagaagcaaa
EXON 7  129 bp
ccatttgagaatgaattcaagaaagcttcagaagatgacattaaaaaagtatgttgtaac
catgaaatttaaaaagagtacttctgacagaaaagtaatcatagtttatacttcctgctt
tttaaatttagacacactgtttttgaacttataaccttttccttattatttgaattatag
ATGCCTCTAGATTTATCCCCTCTTGCAACACCTATCATAAGAAGCAAAATTGAGGAGCCT
TCTGTTGTAGAAACAACTCACCAGGATAGTCCTTTACCTCACCCAGAGTCTACTACCAGT
GATGAGAAG
gttagaaatttttagaaatacaaagtaagggggaggaacagtacccaaataaagtttact
atttaatctccataaaatgttaatgtattaaattcagtgtcagcttgcaatagttttata
tgtgaaagcctgtcaatactcagatatttcagggtaagaagactgcagcttttattgtac
EXON 8  179 bp
aacattgcatttgaatctttacagctcttctaaaatgttcttttaattaatttgagatat
taatttgcttttagcagttattattctgtagatgcttttagaagtgtgttacattctgtt
cactaaggtacatgatttgtatttttaaatgccacccttttttatctcattgttaaatag
GAAGTACCATTGGCACAAACTGCACAGCCCACATCAGCTATTGTTCGTCCAGCATCATTA
CAGGTTCCCAATGTGCTGCTTACAAGTTCTGACTCAAGTGTAATTATTCAGCAGGCAGTA
CCTTCACCAACCTCAAGTACTGTAATCACCCAGGCACCATCCTCTAACAGGCCAATTGT
gtaagtgattcaggccaatcattgaacatatacatgaattaagtttgttttgtaatgatt
tttcctaagacatttgattattcaaactaagatcttagttttgtatgtgtgtgcatgctt
cgaattttggaaaaagtacttgcgtagtcttctttaatataaatattaactaacagagtg
EXON 9  115 bp
tacacaggttatgcatttaagatgcaattaaaaataattaaattttgctatttgctttgc
tgtggttagaaaatgtatttttaaatgatatgattataggagtaaaaatactattgtatt
tttaagagacagttggtatgaatctcttttttaaaatttctcttcttttgtttttcttag
CCCTGTACCAGGCCCATTTCCTCTTCTGTTACATCTTCCTAATGGACAAACCATGCCTGT
TGCTATTCCTGCATCAATTACAAGTTCTAATGTGCATGTTCCAGCTGCAGTCCCA
gtaagaaagttagactatttaaatctctatcgcaaaactgatctttgtagtcagaaaata
aagttggctgcttgactggcttatgaaattgaatttaacataatattgattagcagttga
tagtatttatttgttatcattgtaatagcatataccattcaaggtatagctattttttct
EXON 10  87 bp
ttttgaaggataagtcaggatataagaccaaataaggatttggtatagagataaaatcag
ctggtgataaatttacaatgttctgattcttaaagtctcaaattattacaacagcagtaa
agtacaaatctcattttgaatatattctctagcaattatttttccttatgtcatgcatag
CTCGTTCGACCAGTCACCATGGTGCCTAGTGTTCCAGGAATCCCAGGTCCTTCCTCTCCC
CAACCAGTACAGTCAGAAGCAAAAATG
gtaagccagattttatttgttctgtacattgcttgaggctgttttgaattaatgttttca
ctaaagcctgcttcaaatgcacaatttagatcacatttttataaagttacggactgtttt
atactatagataaaccacaaaatttgaaaaaagaaatcttcctttagcatagtgagtagt
EXON 11  150 bp
tttaaggcctttattattattttctcaaaattcactaggaacagcaaaatacagaatcct
ctagtagtactaggcaaaaggactcagggaaactacccaaggtgctattgtttgtcttgt
tgatattcatgatgatctttaaggacttaaaaaaaatttttaatggtgtttgcattgcag
AGATTAAAAGCTGCTTTGACCCAGCAACATCCTCCAGTTACCAATGGTGATACTGTCAAA
GGTCATGGTAGCGGATTGGTTAGGACTCAGTCAGAGGAATCTCGACCGCAGTCATTACAA
CAGCCAGCCACATCCACTACAGAAACTCCG
gtatgtgtgttgtttttattattcagcactctgtcatctttaaacagaaaagtacagtgt
aacttacggcttatttaaaaaatattactctggtcatgttgttattccaaagatgtatca
aaagcctcaggaaaaggtagctcagtatacaagtattgatacaaaaataaacataataga
EXON 12  207 bp
ataagtatattcaagaaggaagttaaaccacagggtgattttcatattgccccaacatac
tgatgtattcaacaagacttagaaaatacagttgctctccccctttgacaccctttactg
cctatgttaattcactcactagatacaaatataacaggctttcatctctgtttataatag
GCTTCTCCAGCTCACACAACTCCACAGACCCAAAGTACAAGTGGTCGTCGGAGAAGAGCA
GCTAACGAAGATCCTGATGAAAAAAGGAGAAAGTTTTTAGAGCGAAATAGAGCAGCAGCT
TCAAGATGCCGACAAAAAAGGAAAGTCTGGGTTCAGTCTTTAGAGAAGAAAGCTGAAGAC
TTGAGTTCATTAAATGGTCAGCTGCAG
gtatggtgcatatatgtgaattttgttttatttcttttttaataattgtgaacatagatt
ttttttttcctagttgggcctccaaacattttaggacatgatattgggtgtgtatggaat
ctatagtaaatcatagttttgtaaacctgtttgtttggatgctgagatgaaataatataa
EXON 13  106 bp
taataaatgctaaaatataaaagctgccctgtgctgattagacatatttaatcagcatat
tttctttgtttttaatgttctgccagtgatgtccaattttatactttaatccttgcttgt
tttaaatagtaaaaaatatgtttagtctgtggtaaggtacataagttgtttcttctccag
AGTGAAGTCACCCTGCTGAGAAATGAAGTGGCACAGCTGAAACAGCTTCTTCTGGCTCAT
AAAGATTGCCCTGTAACCGCCATGCAGAAGAAATCTGGCTATCATA
gtgagtaatgttccattacctatagccttaggctacgtcagtgaaataccgtcagagtga
actgagctgctactttaaaaatggagactgtgcttctaatattcaagattaaatatcaga
atttctgtaaggttattatagaatgcagtagagaggtataattttttagaatctagagag
EXON 14  556 bp
ttttgacctattgcaggtaaaattgcctacttcatgacctatatcaattgctgtaatacc
aacttgtctaatcagttttgtaagatactttctaactttttactctgtgtattgcctcag
catactggtgcattcttaccgattttaggaaaatgaataatttttcttttttccacccag
CTGCTGATAAAGATGATAGTTCAGAAGACATTTCAGTGCCGAGTAGTCCACATACAGAAG
CTATACAGCATAGTTCGGTCAGCACATCCAATGGAGTCAGTTCAACCTCCAAGGCAGAAG
CTGTAGCCACTTCAGTCCTCACCCAGATGGCGGACCAGAGTACAGAGCCTGCTCTTTCAC
AGATCGTTATGGCTCCTTCCTCCCAGTCACAGCCCTCAGGAAGTTGATTAAAAACCTGCA
GTACAACAGTTTTAGATACTCATTAGTGACTTCAAAGGGAAATCAAGGAAAGACCAGTTT
CCATTTATGCGAAATCTGTGGTTGTAAATTTTTTTTTTTTACTTGAAATTAAATTTGGCT
CTAAAGTTGGTGTAGCAGCAGTTGATCAGACTGAAAAACGGTTTTTAGTCTCTGGAAAAA
GACTGATTTTGCTTTTTTTATAAATATTATTAGATTTATTAATTTTTCTGTGCTCAATGT
GTAAATTGTATTATAATTCATTGTGATTTATTTCACTTTTAATTTGCTGGTGTTTTAATA
AATGGGGGTGTTACTG
aatctttcttcccacttccatttcttttgaccaccccttaaccctcaactgtgacggtag
tagtattatcatttataccaaagttttgcatagtccctgttgactttgtaatgttaacgg
agtcataaaagcactaggcaagagaaagatagaaatttgcttttaatctttttgcctttt