Gene APOB Variant 1
DNA : 42.64 KbNT_022184
mRNA : 14121 bp NM_000384
CDS : 13692 bp NP_000375
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  210 bp
cctggtggctgcggctgcatcccaggtgggccccctccccgaggctcttcaaggctcaaa
gagaagccagtgtagaaaagcaaacaggtcaggcccgggaggcgccctttggaccttttg
caatcctggcgctcttgcagcctgggcttcctataaatggggtgcgggcgccggccgcgc
ATTCCCACCGGGACCTGCGGGGCTGAGTGCCCTTCTCGGTTGCTGCCGCTGAGGAGCCCG
CCCAGCCAGCCAGGGCCGCGAGGCCGAGGCCAGGCCGCAGCCCAGGAGCCGCCCCACCGC
AGCTGGCGATGGACCCGCCGAGGCCCGCGCTGCTGGCGCTGCTGGCGCTGCCTGCGCTGC
TGCTGCTGCTGCTGGCGGGCGCCAGGGCCG
gtgagtgcgcggccgctctgcgggcgcagagggagcgggagggagccggcggcacgaggt
tggccggggcagcctgggcctaggccagagggagggcagccacagggtccagggcgagtg
gggggattggaccagctggcggcccctgcaggctcaggatggggggcgcgggatggaggg
EXON 2  39 bp
cagctggcggcccctgcaggctcaggatggggggcgcgggatggaggggctgaggagggg
gtctccggagcctgcctccctcctgaaaggtgaaacctgtgccggtggtccccctgtcgg
gccctagcacccgctgggaagacgtgggaagctcacagatttctttctcctgtcttacag
AAGAGGAAATGCTGGAAAATGTCAGCCTGGTCTGTCCAA
gtaaggcatctgcgcatggggcgtggaagggcgcccagccccgtgcactctcctacaccc
gggtccctgagggcctcccactctacagggctgagatggcatcgtggtgtgccttgctct
gaccccaggaagcaagttccctgagcctctgcccacacccaagggatgccaactctcttc
EXON 3  116 bp
aaaaacataatggagaagtcaaatctataaaggaaaattaagtataaagtcaattaaaaa
ataatttgagttgaattaccatttttaattctctatgccactgcccctctctgcccagaa
ttggctgtccttgggagagctatttctgctatgtggctgacgtatttctccccacgttag
AAGATGCGACCCGATTCAAGCACCTCCGGAAGTACACATACAACTATGAGGCTGAGAGTT
CCAGTGGAGTCCCTGGGACTGCTGATTCAAGAAGTGCCACCAGGATCAACTGCAAG
gtatggaggatgcaggcaggagggacctagagcccacagctttcccccagccctgttcca
gcgggcgcccaacacgcgaccttcccggagggtgtgtactgagcaaacgcagaacatccc
agaactgttgtaatctgatcaaagcactgggactttgcctctgtttgtaagtcagccaca
EXON 4  146 bp
ggttggtgcacagagaacccaggaggcatgttgataaggcatgtggtgttgaggcgcagg
cagtggtgttcccagcaccattccctttggtgctctgattagagattaagccctgggctt
caggggccacctctcattcttgatagacaacctcaatgctctgctaccctgaattctcag
GTTGAGCTGGAGGTTCCCCAGCTCTGCAGCTTCATCCTGAAGACCAGCCAGTGCACCCTG
AAAGAGGTGTATGGCTTCAACCCTGAGGGCAAAGCCTTGCTGAAGAAAACCAAGAACTCT
GAGGAGTTTGCTGCAGCCATGTCCAG
gtaagtcatgttgtacatgagcacacgcatgtgtgtgtgtccgctgaggtatgaacttgt
gtgtttgcaccaggcacggatgtgactgtaagtatttgtattccgtatccatcgtggatc
agggaattactgagttttcacaatcatcaaaaagagagaagcattagttaaccttcccta
EXON 5  154 bp
gcatacttttttgaaaatgtatgtctatgtgtagctatattctatatttacaaataaatg
atgtcagaagaacaattggttaaaaaaatatgagaaaagaaacttcagtgccacccagct
tacttccagcaagttgtaatggagaaggacatttccgtgaccatcctctctctgggacag
GTATGAGCTCAAGCTGGCCATTCCAGAAGGGAAGCAGGTTTTCCTTTACCCGGAGAAAGA
TGAACCTACTTACATCCTGAACATCAAGAGGGGCATCATTTCTGCCCTCCTGGTTCCCCC
AGAGACAGAAGAAGCCAAGCAAGTGTTGTTTCTG
gtgaggatttagaaagctgatagcagtggcccttgaaactcatcttcatgtgttagagac
cagtcctaccatatacaaagcagatcactgagtcagctccatgactagttacataggaag
ccctggattggcgtgaaatactggtgcccgaggttcctcctgccccttaggctcactgac
EXON 6  156 bp
tcccaacttgggctggccaggcactagcaagaccacactctgcataggaagaaaaagaaa
gtccctcccaaagctagattccttctgctttttctttcacgatccccaccccatccctcc
caagtacccaaggatgttgcccgtgttgaatacatgtggttgcatcttcttcctccatag
GATACCGTGTATGGAAACTGCTCCACTCACTTTACCGTCAAGACGAGGAAGGGCAATGTG
GCAACAGAAATATCCACTGAAAGAGACCTGGGGCAGTGTGATCGCTTCAAGCCCATCCGC
ACAGGCATCAGCCCACTTGCTCTCATCAAAGGCATG
gtaagtcccatgtcagcactgtcgtgcacagcaaggagcatcctcttattaatacaattc
cagaacttttgagctagtgggcacctttgaggacagcctgccctggctgttttttataca
gactagagataggaccctgagcaggcacgggaaggtctgcccaggcttcacggcctggga
EXON 7  125 bp
cagctttggggatgccgacttgttgcaccccctggtctaaatgtcaagtacccagttatc
ttctttctctgagtttatctagtggtacaggactcctgctcccttctaccttgaaggtaa
atgcttttaacagaagatacagggactgatcaaaatgctcgtctccaatctctttcatag
ACCCGCCCCTTGTCAACTCTGATCAGCAGCAGCCAGTCCTGTCAGTACACACTGGACGCT
AAGAGGAAGCATGTGGCAGAAGCCATCTGCAAGGAGCAACACCTCTTCCTGCCTTTCTCC
TACAA
gtaggtcatgtgatgcacccctgatttgtcatttaatgggtcagtgtgaactgaacactt
ctcaagtgctctgttccaggcaaacctgtgcctgggagggaggaatggagagggataaaa
tgccgcccctccctgtccccctttttaagcgaacaggccatttggcagaaaagtcctagg
EXON 8  86 bp
taactagcgtgaccaggaagaggtggatgttattcattcagggccaacaatggctggatt
tacccatgctttgaaagatgggcaggacttgggtagatgcagagacagggaaaaccttca
acatggaaagaatagtatgttctggccatccgtgacatggtgtgcttccttggttaccag
GAATAAGTATGGGATGGTAGCACAAGTGACACAGACTTTGAAACTTGAAGACACACCAAA
GATCAACAGCCGCTTCTTTGGTGAAG
gtaagagtttctgtccacatagttgctggaaaatctactcaagatgtgcctatcatggct
tagccacttgctgagccctgttaaatgtctgctgactaacaagtgatacagacactggtg
ttctggctacctctagtgagaaagcaaactcatttcatgatgtcaagttgcaatggcata
EXON 9  220 bp
tgagtcagtgaaaacaagtcaatcacctatggcagagccagatctagcaggcattgaata
caggatagtttctttcccttttcccctgtgctgatactccacaatttccagcttccagta
gacaaagatatggttgagatgaagaaagctagagttcctttgacactttccatcttccag
GTACTAAGAAGATGGGCCTCGCATTTGAGAGCACCAAATCCACATCACCTCCAAAGCAGG
CCGAAGCTGTTTTGAAGACTCTCCAGGAACTGAAAAAACTAACCATCTCTGAGCAAAATA
TCCAGAGAGCTAATCTCTTCAATAAGCTGGTTACTGAGCTGAGAGGCCTCAGTGATGAAG
CAGTCACATCTCTCTTGCCACAGCTGATTGAGGTGTCCAG
gtatctaatggttacagctcaactttttataaaactgatggtaactgactgaactttcaa
accttggccaaatggagaatctcagggaccatttggatatcaatccagttaatcaattag
tcaatcagttcatgattgctggatagagaactatcagctgctgcgctgagttccatgaaa
EXON 10  228 bp
tctgtgggtaatattcctaaggaaagcatcatggttctgagctccaagttgggttttgaa
gttagatttgaatagtgaatgaggtgattaagggctctcctggcagaggacacaccatga
gcaatattttatgtgccctgaaggtggtctgtataactttatccatgtctttcttctcag
CCCCATCACTTTACAAGCCTTGGTTCAGTGTGGACAGCCTCAGTGCTCCACTCACATCCT
CCAGTGGCTGAAACGTGTGCATGCCAACCCCCTTCTGATAGATGTGGTCACCTACCTGGT
GGCCCTGATCCCCGAGCCCTCAGCACAGCAGCTGCGAGAGATCTTCAACATGGCGAGGGA
TCAGCGCAGCCGAGCCACCTTGTATGCGCTGAGCCACGCGGTCAACAA
gtgagtttccacactgtatttctcctcctaggagcagaggaacatcttgcacctctgtgc
atctctgtattaaaactgaacccctccttccactttcaaactctgctccttactcttgtg
ttttttcttgatcatttttggggtaatgacttgaaataagaaatcagcaaacacaaattg
EXON 11  118 bp
gaagtcaggtaatgtgatgcctccagctatgttctttttgcttaaaattgcttcagctat
tcaggctctttttggattccatatgaattttataattattttttctaattcacaagtttg
ggttttaagacaaacctaactggggttaccaagtcctgactctcttctcttattctgtag
CTATCATAAGACAAACCCTACAGGGACCCAGGAGCTGCTGGACATTGCTAATTACCTGAT
GGAACAGATTCAAGATGACTGCACTGGGGATGAAGATTACACCTATTTGATTCTGCGG
gtaatctcagtcttttatatgacatacatcatttcagaagcacttttcctggacaccttt
tacttccctctcctgcaccctgatgggttcttgtttcttttcttcaatgcaggtcattgg
aaatatgggccaaaccatggagcagttaactccagaactcaagtcttcaatcctgaaatg
EXON 12  147 bp
attacctgatggaacagattcaagatgactgcactggggatgaagattacacctatttga
ttctgcgggtaatctcagtcttttatatgacatacatcatttcagaagcacttttcctgg
acaccttttacttccctctcctgcaccctgatgggttcttgtttcttttcttcaatgcag
GTCATTGGAAATATGGGCCAAACCATGGAGCAGTTAACTCCAGAACTCAAGTCTTCAATC
CTGAAATGTGTCCAAAGTACAAAGCCATCACTGATGATCCAGAAAGCTGCCATCCAGGCT
CTGCGGAAAATGGAGCCTAAAGACAAG
gtaaagtccacaagaagaggtctgaaagtgaaagtttattaacaaggatttggaaggtac
taggggaatgagactctagatttcatctactgactttattctgctgtttctttcctttcc
ttccttccttccttccttccttcctccctccctccctttcttctttccttccttccttcc
EXON 13  212 bp
ttacttgatagtgctctaggaaacactggcaagaagattcaataccagcatttgaagaac
gattacagagaaattagacctgtgcttaagaaagagctagcagacaatgccagtgtttgc
caggcatgttctgtgttctgaccacaggacagtgataaccatctcctcttttgactgcag
GACCAGGAGGTTCTTCTTCAGACTTTCCTTGATGATGCTTCTCCGGGAGATAAGCGACTG
GCTGCCTATCTTATGTTGATGAGGAGTCCTTCACAGGCAGATATTAACAAAATTGTCCAA
ATTCTACCATGGGAACAGAATGAGCAAGTGAAGAACTTTGTGGCTTCCCATATTGCCAAT
ATCTTGAACTCAGAAGAATTGGATATCCAAGA
gtaagtaagagctattcaccccatataccactgagggccctgagctggaattccaaccct
aggttttggcatagccactgtctgcccttgcttctgaaacaaacacttgtgcaaatgtgt
agcagatctagacccaaagacttagggtcaatgaaatcaagacattttggtagtgattgg
EXON 14  238 bp
ctgcccttgcttctgaaacaaacacttgtgcaaatgtgtagcagatctagacccaaagac
ttagggtcaatgaaatcaagacattttggtagtgattggaaatccatatttacttggggt
gcaagagtcaaaggataataacatggtgtgtcagctcaaaatatacttcttcttatctag
TCTGAAAAAGTTAGTGAAAGAAGCTCTGAAAGAATCTCAACTTCCAACTGTCATGGACTT
CAGAAAATTCTCTCGGAACTATCAACTCTACAAATCTGTTTCTCTTCCATCACTTGACCC
AGCCTCAGCCAAAATAGAAGGGAATCTTATATTTGATCCAAATAACTACCTTCCTAAAGA
AAGCATGCTGAAAACTACCCTCACTGCCTTTGGATTTGCTTCAGCTGACCTCATCGAG
gtaagtgtgaagagtttgaggttctctagcccattttgtacagcatcataaacagagagt
ccctgggagccaggagctacccagaggaaaactaagaaccaccaggcacttcctaccatg
attctgaggctttcttctttccctccttccccgccttcctctctccccgctaggggtcac
EXON 15  177 bp
ataaggtcaagattctagtgagattttaataaagcagctcctgtgaaatgctaaggtcag
ctcctggcctgtggtattcaaatacttgtttagataaatggacatcaagagtggggacta
ctaggctggcatacaacaaagaaacctgatgccattttcttgtctgattttctttctcag
ATTGGCTTGGAAGGAAAAGGCTTTGAGCCAACATTGGAAGCTCTTTTTGGGAAGCAAGGA
TTTTTCCCAGACAGTGTCAACAAAGCTTTGTACTGGGTTAATGGTCAAGTTCCTGATGGT
GTCTCTAAGGTCTTAGTGGACCACTTTGGCTATACCAAAGATGATAAACATGAGCAG
gtgtgtatttgtgaagtatcttcttaaggaaagctttgggtctcaatgcaaaaacaattc
ttttctaagcatggaagtcctcaaaatactatctaactgaagggataactatggttttta
tcaaccagacctgctggggtaagggccagtatcctctgcagttaaagatctcctgaattc
EXON 16  192 bp
agaccttagttctttaatctctgcttagaggaattagcctggacttcagtgtctccctgt
tcctcacctggagcattttttaggcccatcctggctgcatcagacaggtcccacattggg
aactgaaaggtgtttgacattgctgacatctcactggccattttattactaaactctcag
GATATGGTAAATGGAATAATGCTCAGTGTTGAGAAGCTGATTAAAGATTTGAAATCCAAA
GAAGTCCCGGAAGCCAGAGCCTACCTCCGCATCTTGGGAGAGGAGCTTGGTTTTGCCAGT
CTCCATGACCTCCAGCTCCTGGGAAAGCTGCTTCTGATGGGTGCCCGCACTCTGCAGGGG
ATCCCCCAGATG
gtaagtcagcaggccccactgggggcccatgagaccagacgttggtttttttttagatcg
cccagactcccttacgatcccagctgcacaagcccgaaaagatgcttgtactttcttcag
agatggaggtttgccttgaatttcactgaagatgactcttggatcacatggaaatgttaa
EXON 17  168 bp
tgaaaacggtaaaaacatcagtttgatctttatttatcaaactattcagctcatcaaaat
atgctagtccttcctttccagataaagaggaattactctccaatgtatgggaggttgtaa
ttaacaaaaccgactttaaaaagacttacttttatttgctctcccttgttgggtctacag
ATTGGAGAGGTCATCAGGAAGGGCTCAAAGAATGACTTTTTTCTTCACTACATCTTCATG
GAGAATGCCTTTGAACTCCCCACTGGAGCTGGATTACAGTTGCAAATATCTTCATCTGGA
GTCATTGCTCCCGGAGCCAAGGCTGGAGTAAAACTGGAAGTAGCCAAC
gtaagattctgtttgccttttgatttcttaggttattactttcttccagggtgcatttct
tgttaaaacatatttaaaaatgtgtttccacttcaagacaaaatgcttcatcattgtaat
cacctcattatttttttatgaaaaacttcaagcttccaccagaatgcactacctcactag
EXON 18  212 bp
tactccaactctagagaactgagaactcgctttccttcttccaaacaaatcccagtaatg
tttccaaaggtctgagttatccaggaaatctttgcccggaggtgagaaagggtggttgat
ctgactgacaggggactgaagtatttaatgaatctgaataggttgttttctgacttatag
ATGCAGGCTGAACTGGTGGCAAAACCCTCCGTGTCTGTGGAGTTTGTGACAAATATGGGC
ATCATCATTCCGGACTTCGCTAGGAGTGGGGTCCAGATGAACACCAACTTCTTCCACGAG
TCGGGTCTGGAGGCTCATGTTGCCCTAAAAGCTGGGAAGCTGAAGTTTATCATTCCTTCC
CCAAAGAGACCAGTCAAGCTGCTCAGTGGAGG
gtaattctttcagccaagtctgcctagccagtttgaaagagagaacagagaatgtacctg
cagaattttgccaggctaaacagttgattgagatcattcaggtcctgaggaagcaggaga
ggagtagaaaggaaagattccgggttacctattttaattctagcctagacttactacata
EXON 19  183 bp
tggcttgtcatgttgatgttctttctaatattatttgtttctcagtaaattaaatagtta
gagataggtgtggactgagggaagacaggaggataagggggtatttgcaccctgagaatt
tgtgatgtccattttgattcatgacttggcaataactcaggtatttttgttcttcaccag
CAACACATTACATTTGGTCTCTACCACCAAAACGGAGGTGATCCCACCTCTCATTGAGAA
CAGGCAGTCCTGGTCAGTTTGCAAGCAAGTCTTTCCTGGCCTGAATTACTGCACCTCAGG
CGCTTACTCCAACGCCAGCTCCACAGACTCCGCCTCCTACTATCCGCTGACCGGGGACAC
CAG
gttagagatgctcagtgcctgacccagcattttctcaccttccacatcatggccacctag
catggcacaggaaaaaatactctgtgttgtaagaccctgtcactagccttctgggtttgc
accatctttgggtatttaaagcagggtcctctggccaacacattgggtgtcaccttttgc
EXON 20  122 bp
ccttgccttgggttcttgtaggactgagggatcaaaaagatcatcttagttaagggcaag
agacaatgttaaaataaggaccatatttttgttgcatttgaggctgaattgttttgggaa
cataatcaccatccttgaaagctctaacattatgcactgtcttcattgtaatgtctttag
ATTAGAGCTGGAACTGAGGCCTACAGGAGAGATTGAGCAGTATTCTGTCAGCGCAACCTA
TGAGCTCCAGAGAGAGGACAGAGCCTTGGTGGATACCCTGAAGTTTGTAACTCAAGCAGA
AG
gtgagtattcaaaacacagctgcctcatctctgctcgcagtctcaggttcagaattcatg
aggagaagacatgtaatttaacctatttaacaaataggttaactgagtacccactaagcg
gcaggcctattctaagacctgggttaactgagtacccaataagcggcaggcctattctaa
EXON 21  211 bp
tgtatttttagtagagacggggtttcaccatgttagccagaatggtcttgatctcctgac
ctcatgatctgcccgccttggcctcccaaagtgctgggattacaggtgtgagccaccgca
cccggcccaaaacatagcttcttaccacacatctcttgattctcttatacactcgtccag
GTGCGAAGCAGACTGAGGCTACCATGACATTCAAATATAATCGGCAGAGTATGACCTTGT
CCAGTGAAGTCCAAATTCCGGATTTTGATGTTGACCTCGGAACAATCCTCAGAGTTAATG
ATGAATCTACTGAGGGCAAAACGTCTTACAGACTCACCCTGGACATTCAGAACAAGAAAA
TTACTGAGGTCGCCCTCATGGGCCACCTAAG
gtaaagaaggccgagggtcatctgacctgcactgcaggcctgggtggttcttttcattat
tcctcttccacttcatacctgaccaagccatgttctcccctagtctacaatcagagtggc
agagagagccctcaacaattttttttttttttgagatggagtctcactctgtcaccaggc
EXON 22  176 bp
caaagtccttaatttgtgctgaatgttggctttagaagttgatgagtttgatctgtggct
gtttctctgaaccatccttgtatctggttttgatcaccacaaatggaacttctgtttaat
cctgcatatctccattgaaaggacaaaatcattggtgccaactgattttctttaccatag
TTGTGACACAAAGGAAGAAAGAAAAATCAAGGGTGTTATTTCCATACCCCGTTTGCAAGC
AGAAGCCAGAAGTGAGATCCTCGCCCACTGGTCGCCTGCCAAACTGCTTCTCCAAATGGA
CTCATCTGCTACAGCTTATGGCTCCACAGTTTCCAAGAGGGTGGCATGGCATTATG
gtatgtgtctcttcccctgtgtgagcacttccaaagtaatgcaggtgttgagacctgtgg
ttacaggctgaactagtaccattcacaactatttcctacgtattttcagatgaagagaag
attgaatttgaatggaacacaggcaccaatgtagataccaaaaaaatgacttccaatttc
EXON 23  188 bp
gcttctccaaatggactcatctgctacagcttatggctccacagtttccaagagggtggc
atggcattatggtatgtgtctcttcccctgtgtgagcacttccaaagtaatgcaggtgtt
gagacctgtggttacaggctgaactagtaccattcacaactatttcctacgtattttcag
ATGAAGAGAAGATTGAATTTGAATGGAACACAGGCACCAATGTAGATACCAAAAAAATGA
CTTCCAATTTCCCTGTGGATCTCTCCGATTATCCTAAGAGCTTGCATATGTATGCTAATA
GACTCCTGGATCACAGAGTCCCTCAAACAGACATGACTTTCCGGCACGTGGGTTCCAAAT
TAATAGTT
gtaagtatgagtctgccagtcaataaatacatggatataagtgctaattacatcctcaac
tctgagctaggtgcaggaaggtttccaaagatgtataaggcatgcttccttccccccagg
gaattcttggggagaaaaaaaaactttcacaagtgtgtagttacccagttacacaaagct
EXON 24  146 bp
tatggacagtgatcagtgactggcaacgaagattcataattttctgttatttatttttaa
ctttcagtgcattgtccagcttaataattaacttgtcaaatcggtatttttgcctaatgt
tcattgctctttgaggctcatccaagcccattaccttaaaaatctcctgtcattttgtag
GCAATGAGCTCATGGCTTCAGAAGGCATCTGGGAGTCTTCCTTATACCCAGACTTTGCAA
GACCACCTCAATAGCCTGAAGGAGTTCAACCTCCAGAACATGGGATTGCCAGACTTCCAC
ATCCCAGAAAACCTCTTCTTAAAAAG
gtaaaagaagaaagcagcaaggcttcttgaaccatgcaaagtaaatgaaagattttacat
agcatgatttagacatttttttaaatttttaaaggaaataatttaagcattttaaggaga
ttaataactatagcacaaacactgtggcatctttgcattagtaaacatgagaacaccaac
EXON 25  374 bp
ttgagtgtttgacaggtggaggtaaaagcaaaggggtccaggcataggagtagcacaaag
aaaagtgcagagtggctttgggaatggggcaagtacaatattgttgtgaaggtcagaggc
agagaactttgaatgactgatgtctgactgtggggatgttatctttgttgttcatttcag
CGATGGCCGGGTCAAATATACCTTGAACAAGAACAGTTTGAAAATTGAGATTCCTTTGCC
TTTTGGTGGCAAATCCTCCAGAGATCTAAAGATGTTAGAGACTGTTAGGACACCAGCCCT
CCACTTCAAGTCTGTGGGATTCCATCTGCCATCTCGAGAGTTCCAAGTCCCTACTTTTAC
CATTCCCAAGTTGTATCAACTGCAAGTGCCTCTCCTGGGTGTTCTAGACCTCTCCACGAA
TGTCTACAGCAACTTGTACAACTGGTCCGCCTCCTACAGTGGTGGCAACACCAGCACAGA
CCATTTCAGCCTTCGGGCTCGTTACCACATGAAGGCTGACTCTGTGGTTGACCTGCTTTC
CTACAATGTGCAAG
gtgagctatgctcaggtaaagggtgcaccgggctagttcatggcaggctctaagaggaga
gcctcctccagggaggaaaggactttggctttctagcagataatcttccttgctacttgg
aagtcttttattttattcaacaaatagaaatatttattaaacatatcacgtgtattaaat
EXON 26  7572 bp
caaggcttcctggaggaatgccttttgctatcagattttatctttgcattacagatggag
gagtctattgcacaattggcccagaaaaatggggctttattattgaaagactttcaacat
agagattgctctggaaatgtactgcttaatttaaccaatgtcttttcatttttatgttag
GATCTGGAGAAACAACATATGACCACAAGAATACGTTCACACTATCATATGATGGGTCTC
TACGCCACAAATTTCTAGATTCGAATATCAAATTCAGTCATGTAGAAAAACTTGGAAACA
ACCCAGTCTCAAAAGGTTTACTAATATTCGATGCATCTAGTTCCTGGGGACCACAGATGT
CTGCTTCAGTTCATTTGGACTCCAAAAAGAAACAGCATTTGTTTGTCAAAGAAGTCAAGA
TTGATGGGCAGTTCAGAGTCTCTTCGTTCTATGCTAAAGGCACATATGGCCTGTCTTGTC
AGAGGGATCCTAACACTGGCCGGCTCAATGGAGAGTCCAACCTGAGGTTTAACTCCTCCT
ACCTCCAAGGCACCAACCAGATAACAGGAAGATATGAAGATGGAACCCTCTCCCTCACCT
CCACCTCTGATCTGCAAAGTGGCATCATTAAAAATACTGCTTCCCTAAAGTATGAGAACT
ACGAGCTGACTTTAAAATCTGACACCAATGGGAAGTATAAGAACTTTGCCACTTCTAACA
AGATGGATATGACCTTCTCTAAGCAAAATGCACTGCTGCGTTCTGAATATCAGGCTGATT
ACGAGTCATTGAGGTTCTTCAGCCTGCTTTCTGGATCACTAAATTCCCATGGTCTTGAGT
TAAATGCTGACATCTTAGGCACTGACAAAATTAATAGTGGTGCTCACAAGGCGACACTAA
GGATTGGCCAAGATGGAATATCTACCAGTGCAACGACCAACTTGAAGTGTAGTCTCCTGG
TGCTGGAGAATGAGCTGAATGCAGAGCTTGGCCTCTCTGGGGCATCTATGAAATTAACAA
CAAATGGCCGCTTCAGGGAACACAATGCAAAATTCAGTCTGGATGGGAAAGCCGCCCTCA
CAGAGCTATCACTGGGAAGTGCTTATCAGGCCATGATTCTGGGTGTCGACAGCAAAAACA
TTTTCAACTTCAAGGTCAGTCAAGAAGGACTTAAGCTCTCAAATGACATGATGGGCTCAT
ATGCTGAAATGAAATTTGACCACACAAACAGTCTGAACATTGCAGGCTTATCACTGGACT
TCTCTTCAAAACTTGACAACATTTACAGCTCTGACAAGTTTTATAAGCAAACTGTTAATT
TACAGCTACAGCCCTATTCTCTGGTAACTACTTTAAACAGTGACCTGAAATACAATGCTC
TGGATCTCACCAACAATGGGAAACTACGGCTAGAACCCCTGAAGCTGCATGTGGCTGGTA
ACCTAAAAGGAGCCTACCAAAATAATGAAATAAAACACATCTATGCCATCTCTTCTGCTG
CCTTATCAGCAAGCTATAAAGCAGACACTGTTGCTAAGGTTCAGGGTGTGGAGTTTAGCC
ATCGGCTCAACACAGACATCGCTGGGCTGGCTTCAGCCATTGACATGAGCACAAACTATA
ATTCAGACTCACTGCATTTCAGCAATGTCTTCCGTTCTGTAATGGCCCCGTTTACCATGA
CCATCGATGCACATACAAATGGCAATGGGAAACTCGCTCTCTGGGGAGAACATACTGGGC
AGCTGTATAGCAAATTCCTGTTGAAAGCAGAACCTCTGGCATTTACTTTCTCTCATGATT
ACAAAGGCTCCACAAGTCATCATCTCGTGTCTAGGAAAAGCATCAGTGCAGCTCTTGAAC
ACAAAGTCAGTGCCCTGCTTACTCCAGCTGAGCAGACAGGCACCTGGAAACTCAAGACCC
AATTTAACAACAATGAATACAGCCAGGACTTGGATGCTTACAACACTAAAGATAAAATTG
GCGTGGAGCTTACTGGACGAACTCTGGCTGACCTAACTCTACTAGACTCCCCAATTAAAG
TGCCACTTTTACTCAGTGAGCCCATCAATATCATTGATGCTTTAGAGATGAGAGATGCCG
TTGAGAAGCCCCAAGAATTTACAATTGTTGCTTTTGTAAAGTATGATAAAAACCAAGATG
TTCACTCCATTAACCTCCCATTTTTTGAGACCTTGCAAGAATATTTTGAGAGGAATCGAC
AAACCATTATAGTTGTACTGGAAAACGTACAGAGAAACCTGAAGCACATCAATATTGATC
AATTTGTAAGAAAATACAGAGCAGCCCTGGGAAAACTCCCACAGCAAGCTAATGATTATC
TGAATTCATTCAATTGGGAGAGACAAGTTTCACATGCCAAGGAGAAACTGACTGCTCTCA
CAAAAAAGTATAGAATTACAGAAAATGATATACAAATTGCATTAGATGATGCCAAAATCA
ACTTTAATGAAAAACTATCTCAACTGCAGACATATATGATACAATTTGATCAGTATATTA
AAGATAGTTATGATTTACATGATTTGAAAATAGCTATTGCTAATATTATTGATGAAATCA
TTGAAAAATTAAAAAGTCTTGATGAGCACTATCATATCCGTGTAAATTTAGTAAAAACAA
TCCATGATCTACATTTGTTTATTGAAAATATTGATTTTAACAAAAGTGGAAGTAGTACTG
CATCCTGGATTCAAAATGTGGATACTAAGTACCAAATCAGAATCCAGATACAAGAAAAAC
TGCAGCAGCTTAAGAGACACATACAGAATATAGACATCCAGCACCTAGCTGGAAAGTTAA
AACAACACATTGAGGCTATTGATGTTAGAGTGCTTTTAGATCAATTGGGAACTACAATTT
CATTTGAAAGAATAAATGACATTCTTGAGCATGTCAAACACTTTGTTATAAATCTTATTG
GGGATTTTGAAGTAGCTGAGAAAATCAATGCCTTCAGAGCCAAAGTCCATGAGTTAATCG
AGAGGTATGAAGTAGACCAACAAATCCAGGTTTTAATGGATAAATTAGTAGAGTTGGCCC
ACCAATACAAGTTGAAGGAGACTATTCAGAAGCTAAGCAATGTCCTACAACAAGTTAAGA
TAAAAGATTACTTTGAGAAATTGGTTGGATTTATTGATGATGCTGTCAAGAAGCTTAATG
AATTATCTTTTAAAACATTCATTGAAGATGTTAACAAATTCCTTGACATGTTGATAAAGA
AATTAAAGTCATTTGATTACCACCAGTTTGTAGATGAAACCAATGACAAAATCCGTGAGG
TGACTCAGAGACTCAATGGTGAAATTCAGGCTCTGGAACTACCACAAAAAGCTGAAGCAT
TAAAACTGTTTTTAGAGGAAACCAAGGCCACAGTTGCAGTGTATCTGGAAAGCCTACAGG
ACACCAAAATAACCTTAATCATCAATTGGTTACAGGAGGCTTTAAGTTCAGCATCTTTGG
CTCACATGAAGGCCAAATTCCGAGAGACCCTAGAAGATACACGAGACCGAATGTATCAAA
TGGACATTCAGCAGGAACTTCAACGATACCTGTCTCTGGTAGGCCAGGTTTATAGCACAC
TTGTCACCTACATTTCTGATTGGTGGACTCTTGCTGCTAAGAACCTTACTGACTTTGCAG
AGCAATATTCTATCCAAGATTGGGCTAAACGTATGAAAGCATTGGTAGAGCAAGGGTTCA
CTGTTCCTGAAATCAAGACCATCCTTGGGACCATGCCTGCCTTTGAAGTCAGTCTTCAGG
CTCTTCAGAAAGCTACCTTCCAGACACCTGATTTTATAGTCCCCCTAACAGATTTGAGGA
TTCCATCAGTTCAGATAAACTTCAAAGACTTAAAAAATATAAAAATCCCATCCAGGTTTT
CCACACCAGAATTTACCATCCTTAACACCTTCCACATTCCTTCCTTTACAATTGACTTTG
TAGAAATGAAAGTAAAGATCATCAGAACCATTGACCAGATGCTGAACAGTGAGCTGCAGT
GGCCCGTTCCAGATATATATCTCAGGGATCTGAAGGTGGAGGACATTCCTCTAGCGAGAA
TCACCCTGCCAGACTTCCGTTTACCAGAAATCGCAATTCCAGAATTCATAATCCCAACTC
TCAACCTTAATGATTTTCAAGTTCCTGACCTTCACATACCAGAATTCCAGCTTCCCCACA
TCTCACACACAATTGAAGTACCTACTTTTGGCAAGCTATACAGTATTCTGAAAATCCAAT
CTCCTCTTTTCACATTAGATGCAAATGCTGACATAGGGAATGGAACCACCTCAGCAAACG
AAGCAGGTATCGCAGCTTCCATCACTGCCAAAGGAGAGTCCAAATTAGAAGTTCTCAATT
TTGATTTTCAAGCAAATGCACAACTCTCAAACCCTAAGATTAATCCGCTGGCTCTGAAGG
AGTCAGTGAAGTTCTCCAGCAAGTACCTGAGAACGGAGCATGGGAGTGAAATGCTGTTTT
TTGGAAATGCTATTGAGGGAAAATCAAACACAGTGGCAAGTTTACACACAGAAAAAAATA
CACTGGAGCTTAGTAATGGAGTGATTGTCAAGATAAACAATCAGCTTACCCTGGATAGCA
ACACTAAATACTTCCACAAATTGAACATCCCCAAACTGGACTTCTCTAGTCAGGCTGACC
TGCGCAACGAGATCAAGACACTGTTGAAAGCTGGCCACATAGCATGGACTTCTTCTGGAA
AAGGGTCATGGAAATGGGCCTGCCCCAGATTCTCAGATGAGGGAACACATGAATCACAAA
TTAGTTTCACCATAGAAGGACCCCTCACTTCCTTTGGACTGTCCAATAAGATCAATAGCA
AACACCTAAGAGTAAACCAAAACTTGGTTTATGAATCTGGCTCCCTCAACTTTTCTAAAC
TTGAAATTCAATCACAAGTCGATTCCCAGCATGTGGGCCACAGTGTTCTAACTGCTAAAG
GCATGGCACTGTTTGGAGAAGGGAAGGCAGAGTTTACTGGGAGGCATGATGCTCATTTAA
ATGGAAAGGTTATTGGAACTTTGAAAAATTCTCTTTTCTTTTCAGCCCAGCCATTTGAGA
TCACGGCATCCACAAACAATGAAGGGAATTTGAAAGTTCGTTTTCCATTAAGGTTAACAG
GGAAGATAGACTTCCTGAATAACTATGCACTGTTTCTGAGTCCCAGTGCCCAGCAAGCAA
GTTGGCAAGTAAGTGCTAGGTTCAATCAGTATAAGTACAACCAAAATTTCTCTGCTGGAA
ACAACGAGAACATTATGGAGGCCCATGTAGGAATAAATGGAGAAGCAAATCTGGATTTCT
TAAACATTCCTTTAACAATTCCTGAAATGCGTCTACCTTACACAATAATCACAACTCCTC
CACTGAAAGATTTCTCTCTATGGGAAAAAACAGGCTTGAAGGAATTCTTGAAAACGACAA
AGCAATCATTTGATTTAAGTGTAAAAGCTCAGTATAAGAAAAACAAACACAGGCATTCCA
TCACAAATCCTTTGGCTGTGCTTTGTGAGTTTATCAGTCAGAGCATCAAATCCTTTGACA
GGCATTTTGAAAAAAACAGAAACAATGCATTAGATTTTGTCACCAAATCCTATAATGAAA
CAAAAATTAAGTTTGATAAGTACAAAGCTGAAAAATCTCACGACGAGCTCCCCAGGACCT
TTCAAATTCCTGGATACACTGTTCCAGTTGTCAATGTTGAAGTGTCTCCATTCACCATAG
AGATGTCGGCATTCGGCTATGTGTTCCCAAAAGCAGTCAGCATGCCTAGTTTCTCCATCC
TAGGTTCTGACGTCCGTGTGCCTTCATACACATTAATCCTGCCATCATTAGAGCTGCCAG
TCCTTCATGTCCCTAGAAATCTCAAGCTTTCTCTTCCAGATTTCAAGGAATTGTGTACCA
TAAGCCATATTTTTATTCCTGCCATGGGCAATATTACCTATGATTTCTCCTTTAAATCAA
GTGTCATCACACTGAATACCAATGCTGAACTTTTTAACCAGTCAGATATTGTTGCTCATC
TCCTTTCTTCATCTTCATCTGTCATTGATGCACTGCAGTACAAATTAGAGGGCACCACAA
GATTGACAAGAAAAAGGGGATTGAAGTTAGCCACAGCTCTGTCTCTGAGCAACAAATTTG
TGGAGGGTAGTCATAACAGTACTGTGAGCTTAACCACGAAAAATATGGAAGTGTCAGTGG
CAACAACCACAAAAGCCCAAATTCCAATTTTGAGAATGAATTTCAAGCAAGAACTTAATG
GAAATACCAAGTCAAAACCTACTGTCTCTTCCTCCATGGAATTTAAGTATGATTTCAATT
CTTCAATGCTGTACTCTACCGCTAAAGGAGCAGTTGACCACAAGCTTAGCTTGGAAAGCC
TCACCTCTTACTTTTCCATTGAGTCATCTACCAAAGGAGATGTCAAGGGTTCGGTTCTTT
CTCGGGAATATTCAGGAACTATTGCTAGTGAGGCCAACACTTACTTGAATTCCAAGAGCA
CACGGTCTTCAGTGAAGCTGCAGGGCACTTCCAAAATTGATGATATCTGGAACCTTGAAG
TAAAAGAAAATTTTGCTGGAGAAGCCACACTCCAACGCATATATTCCCTCTGGGAGCACA
GTACGAAAAACCACTTACAGCTAGAGGGCCTCTTTTTCACCAACGGAGAACATACAAGCA
AAGCCACCCTGGAACTCTCTCCATGGCAAATGTCAGCTCTTGTTCAGGTCCATGCAAGTC
AGCCCAGTTCCTTCCATGATTTCCCTGACCTTGGCCAGGAAGTGGCCCTGAATGCTAACA
CTAAGAACCAGAAGATCAGATGGAAAAATGAAGTCCGGATTCATTCTGGGTCTTTCCAGA
GCCAGGTCGAGCTTTCCAATGACCAAGAAAAGGCACACCTTGACATTGCAGGATCCTTAG
AAGGACACCTAAGGTTCCTCAAAAATATCATCCTACCAGTCTATGACAAGAGCTTATGGG
ATTTCCTAAAGCTGGATGTAACCACCAGCATTGGTAGGAGACAGCATCTTCGTGTTTCAA
CTGCCTTTGTGTACACCAAAAACCCCAATGGCTATTCATTCTCCATCCCTGTAAAAGTTT
TGGCTGATAAATTCATTATTCCTGGGCTGAAACTAAATGATCTAAATTCAGTTCTTGTCA
TGCCTACGTTCCATGTCCCATTTACAGATCTTCAGGTTCCATCGTGCAAACTTGACTTCA
GAGAAATACAAATCTATAAGAAGCTGAGAACTTCATCATTTGCCCTCAACCTACCAACAC
TCCCCGAGGTAAAATTCCCTGAAGTTGATGTGTTAACAAAATATTCTCAACCAGAAGACT
CCTTGATTCCCTTTTTTGAGATAACCGTGCCTGAATCTCAGTTAACTGTGTCCCAGTTCA
CGCTTCCAAAAAGTGTTTCAGATGGCATTGCTGCTTTGGATCTAAATGCAGTAGCCAACA
AGATCGCAGACTTTGAGTTGCCCACCATCATCGTGCCTGAGCAGACCATTGAGATTCCCT
CCATTAAGTTCTCTGTACCTGCTGGAATTGTCATTCCTTCCTTTCAAGCACTGACTGCAC
GCTTTGAGGTAGACTCTCCCGTGTATAATGCCACTTGGAGTGCCAGTTTGAAAAACAAAG
CAGATTATGTTGAAACAGTCCTGGATTCCACATGCAGCTCAACCGTACAGTTCCTAGAAT
ATGAACTAAATG
gtaagaaatatcctgcctcctctcctagatactgtatattttcaatgagagttatgagta
aataattatgtatttagttgtgagtagatgtacaattactcaatgtcacaaaattttaag
taagaaaagagatacatgtataccctacacgtaaaaaccaaactgtagaaaatctagtgt
EXON 27  115 bp
tattttaggactaacaatgtcttttaactatttattttaaaataagtgtgagctgtacat
tgcatattttaaacacaagtgaaatatctggttaggatagaattctcccagttttcacaa
tgaaaacatcaacgtcctactgttatgaatctaataaaatacaaaatctctcctatacag
TTTTGGGAACACACAAAATCGAAGATGGTACGTTAGCCTCTAAGACTAAAGGAACATTTG
CACACCGTGACTTCAGTGCAGAATATGAAGAAGATGGCAAATATGAAGGACTTCA
gtatggagcttttattgaattgaaaccttataccttttgaaaactcattgtgattttctt
catctccatacccctttcgtgatagctcatctgtttttctgctttcagggaatgggaagg
aaaagcgcacctcaatatcaaaagcccagcgttcaccgatctccatctgcgctaccagaa
EXON 28  184 bp
gactaaaggaacatttgcacaccgtgacttcagtgcagaatatgaagaagatggcaaata
tgaaggacttcagtatggagcttttattgaattgaaaccttataccttttgaaaactcat
tgtgattttcttcatctccatacccctttcgtgatagctcatctgtttttctgctttcag
GGAATGGGAAGGAAAAGCGCACCTCAATATCAAAAGCCCAGCGTTCACCGATCTCCATCT
GCGCTACCAGAAAGACAAGAAAGGCATCTCCACCTCAGCAGCCTCCCCAGCCGTAGGCAC
CGTGGGCATGGATATGGATGAAGATGACGACTTTTCTAAATGGAACTTCTACTACAGCCC
TCAG
gtaaataccacctaatgagtgacacgcccccaagagcgagtggagaattggggcagatac
atttaattcaggaccaaatattcagagattccccaaactaggtgaaagacaggcggtaag
caacttcttctctgaggaaatattctctagaaagtattacaatgagtccttgattgattt
EXON 29  1906 bp
aacagtagacttatttaaccataaaacaaacacatgaactgacatatgaaagataaatcc
ctttcagtatatgaaagattctctgatctttatttttaactgctaatgaagttttagtgt
actatattgtgtaattggagtaattgaaaacatgttatttttttttttctctctgtttag
TCCTCTCCAGATAAAAAACTCACCATATTCAAAACTGAGTTGAGGGTCCGGGAATCTGAT
GAGGAAACTCAGATCAAAGTTAATTGGGAAGAAGAGGCAGCTTCTGGCTTGCTAACCTCT
CTGAAAGACAACGTGCCCAAGGCCACAGGGGTCCTTTATGATTATGTCAACAAGTACCAC
TGGGAACACACAGGGCTCACCCTGAGAGAAGTGTCTTCAAAGCTGAGAAGAAATCTGCAG
AACAATGCTGAGTGGGTTTATCAAGGGGCCATTAGGCAAATTGATGATATCGACGTGAGG
TTCCAGAAAGCAGCCAGTGGCACCACTGGGACCTACCAAGAGTGGAAGGACAAGGCCCAG
AATCTGTACCAGGAACTGTTGACTCAGGAAGGCCAAGCCAGTTTCCAGGGACTCAAGGAT
AACGTGTTTGATGGCTTGGTACGAGTTACTCAAGAATTCCATATGAAAGTCAAGCATCTG
ATTGACTCACTCATTGATTTTCTGAACTTCCCCAGATTCCAGTTTCCGGGGAAACCTGGG
ATATACACTAGGGAGGAACTTTGCACTATGTTCATAAGGGAGGTAGGGACGGTACTGTCC
CAGGTATATTCGAAAGTCCATAATGGTTCAGAAATACTGTTTTCCTATTTCCAAGACCTA
GTGATTACACTTCCTTTCGAGTTAAGGAAACATAAACTAATAGATGTAATCTCGATGTAT
AGGGAACTGTTGAAAGATTTATCAAAAGAAGCCCAAGAGGTATTTAAAGCCATTCAGTCT
CTCAAGACCACAGAGGTGCTACGTAATCTTCAGGACCTTTTACAATTCATTTTCCAACTA
ATAGAAGATAACATTAAACAGCTGAAAGAGATGAAATTTACTTATCTTATTAATTATATC
CAAGATGAGATCAACACAATCTTCAGTGATTATATCCCATATGTTTTTAAATTGTTGAAA
GAAAACCTATGCCTTAATCTTCATAAGTTCAATGAATTTATTCAAAACGAGCTTCAGGAA
GCTTCTCAAGAGTTACAGCAGATCCATCAATACATTATGGCCCTTCGTGAAGAATATTTT
GATCCAAGTATAGTTGGCTGGACAGTGAAATATTATGAACTTGAAGAAAAGATAGTCAGT
CTGATCAAGAACCTGTTAGTTGCTCTTAAGGACTTCCATTCTGAATATATTGTCAGTGCC
TCTAACTTTACTTCCCAACTCTCAAGTCAAGTTGAGCAATTTCTGCACAGAAATATTCAG
GAATATCTTAGCATCCTTACCGATCCAGATGGAAAAGGGAAAGAGAAGATTGCAGAGCTT
TCTGCCACTGCTCAGGAAATAATTAAAAGCCAGGCCATTGCGACGAAGAAAATAATTTCT
GATTACCACCAGCAGTTTAGATATAAACTGCAAGATTTTTCAGACCAACTCTCTGATTAC
TATGAAAAATTTATTGCTGAATCCAAAAGATTGATTGACCTGTCCATTCAAAACTACCAC
ACATTTCTGATATACATCACGGAGTTACTGAAAAAGCTGCAATCAACCACAGTCATGAAC
CCCTACATGAAGCTTGCTCCAGGAGAACTTACTATCATCCTCTAATTTTTTAAAAGAAAT
CTTCATTTATTCTTCTTTTCCAATTGAACTTTCACATAGCACAGAAAAAATTCAAACTGC
CTATATTGATAAAACCATACAGTGAGCCAGCCTTGCAGTAGGCAGTAGACTATAAGCAGA
AGCACATATGAACTGGACCTGCACCAAAGCTGGCACCAGGGCTCGGAAGGTCTCTGAACT
CAGAAGGATGGCATTTTTTGCAAGTTAAAGAAAATCAGGATCTGAGTTATTTTGCTAAAC
TTGGGGGAGGAGGAACAAATAAATGGAGTCTTTATTGTGTATCATA
ccactgaatgtggctcatttgtattgaaagacagtgaaacgagggcattgataaaatgtt
ctggcacagcaaaacctctagaacacatagtgtgatttaagtaacagaataaaaatggaa
acggagaaattatggagggaaatattttgcaaaaatatttaaaaagatgaggtaattgtg