Gene ALPP Variant 1
DNA : 4.13 KbNT_005403
mRNA : 2748 bp NM_001632
CDS : 1608 bp NP_001623
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  129 bp
acctgagctgcctttctcaggaccccagccccagcccggcccagcccagccacaccctgc
cactcccttcagccagtgtggcttcaggtcaagaggctgggcagggtcaaggtggcaacg
aggggagaagccgggacacagttctccctgatttaaacccgggcagcctggagtgcagct
CATACTCCATGCCCAGAATTCCTGCCTCGCCACTGTCCTGCTGCCCTCCAGACATGCTGG
GGCCCTGCATGCTGCTGCTGCTGCTGCTGCTGGGCCTGAGGCTACAGCTCTCCCTGGGCA
TCATCCCAG
gtaatgaggctccccgagctgcccctacacaacacacacacagggcaccccccagcccag
gctgacctgatttttgctctccccctggccagttgaggaggagaacccggacttctggaa
ccgcgaggcagccgaggccctgggtgccgccaagaagctgcagcctgcacagacagccgc
EXON 2  117 bp
tgccctccagacatgctggggccctgcatgctgctgctgctgctgctgctgggcctgagg
ctacagctctccctgggcatcatcccaggtaatgaggctccccgagctgcccctacacaa
cacacacacagggcaccccccagcccaggctgacctgatttttgctctccccctggccag
TTGAGGAGGAGAACCCGGACTTCTGGAACCGCGAGGCAGCCGAGGCCCTGGGTGCCGCCA
AGAAGCTGCAGCCTGCACAGACAGCCGCCAAGAACCTCATCATCTTCCTGGGCGATG
gtgagtgagccaggccttccagccctgcagccctcacagccccggcgcccggaccctcag
tggttccaggagagccctggggcccaagcctcacacatttctgttccttcagggatgggg
gtgtctacggtgacagctgccaggatcctaaaagggcagaagaaggacaaactggggcct
EXON 3  116 bp
gggtgccgccaagaagctgcagcctgcacagacagccgccaagaacctcatcatcttcct
gggcgatggtgagtgagccaggccttccagccctgcagccctcacagccccggcgcccgg
accctcagtggttccaggagagccctggggcccaagcctcacacatttctgttccttcag
GGATGGGGGTGTCTACGGTGACAGCTGCCAGGATCCTAAAAGGGCAGAAGAAGGACAAAC
TGGGGCCTGAGATACCCCTGGCCATGGACCGCTTCCCATATGTGGCTCTGTCCAAG
gtaagtgctgggctaccttagagtcctccaagcacagaaggggaatcctggctatggagt
gtggtaggagggagggaccctaaacagctggggctccagtaaggagttagaggcagttgg
aatcccagaggacagagatcagggtctgggtctccgtgtctgccccagagaagagctcag
EXON 4  175 bp
ttagagtcctccaagcacagaaggggaatcctggctatggagtgtggtaggagggaggga
ccctaaacagctggggctccagtaaggagttagaggcagttggaatcccagaggacagag
atcagggtctgggtctccgtgtctgccccagagaagagctcagagtgtctctgtccccag
ACATACAATGTAGACAAACATGTGCCAGACAGTGGAGCCACAGCCACGGCCTACCTGTGC
GGGGTCAAGGGCAACTTCCAGACCATTGGCTTGAGTGCAGCCGCCCGCTTTAACCAGTGC
AACACGACACGCGGCAACGAGGTCATCTCCGTGATGAATCGGGCCAAGAAAGCAG
gtgagctggggcccgctgctgggtcacggccaggtcacagacgttggtcacatatactga
cctctgacacccttagggaagtcagtgggagtggtaaccaccacacgagtgcagcacgcc
tcgccagccggcacctacgcccacacggtgaaccgcaactggtactcggacgccgacgtg
EXON 5  173 bp
caacttccagaccattggcttgagtgcagccgcccgctttaaccagtgcaacacgacacg
cggcaacgaggtcatctccgtgatgaatcgggccaagaaagcaggtgagctggggcccgc
tgctgggtcacggccaggtcacagacgttggtcacatatactgacctctgacacccttag
GGAAGTCAGTGGGAGTGGTAACCACCACACGAGTGCAGCACGCCTCGCCAGCCGGCACCT
ACGCCCACACGGTGAACCGCAACTGGTACTCGGACGCCGACGTGCCTGCCTCCGCCCGCC
AGGAGGGGTGCCAGGACATCGCTACGCAGCTCATCTCCAACATGGACATTGAC
gtgcgacccccaggccaagggctggggctgggcagagagtagcagggagggggcactagc
tcagacccaggcaaccaaaagccttatctgggccagcagggtctggaggtggggttgtgg
gcgtagaaggtgcagcccaggctgggccattcccacagccttggggaggggagtcagggg
EXON 6  135 bp
ggcaaccaaaagccttatctgggccagcagggtctggaggtggggttgtgggcgtagaag
gtgcagcccaggctgggccattcccacagccttggggaggggagtcaggggctgtgcatg
aggagggggcacggggccagccagggccccaaatccacctgccccatcctctgttcccag
GTGATCCTAGGTGGAGGCCGAAAGTACATGTTTCGCATGGGAACCCCAGACCCTGAGTAC
CCAGATGACTACAGCCAAGGTGGGACCAGGCTGGACGGGAAGAATCTGGTGCAGGAATGG
CTGGCGAAGCGCCAG
gtgatgggggctggcgggtgcagggggcacagcagggggagggcagaggtgtggggctca
gggctgtgggctgaggcctggctctctccctccccacagggtgcccggtatgtgtggaac
cgcactgagctcatgcaggcttccctggacccgtctgtgacccatctcatgggtaatgac
EXON 7  73 bp
gagtacccagatgactacagccaaggtgggaccaggctggacgggaagaatctggtgcag
gaatggctggcgaagcgccaggtgatgggggctggcgggtgcagggggcacagcaggggg
agggcagaggtgtggggctcagggctgtgggctgaggcctggctctctccctccccacag
GGTGCCCGGTATGTGTGGAACCGCACTGAGCTCATGCAGGCTTCCCTGGACCCGTCTGTG
ACCCATCTCATGG
gtaatgacccccttcctgccctggcatccctcagatggcctcagatggcaccttctgagc
ctgtgtgcacatccgccagcacccgcccacccccagcctgccagtcaccacaggacccct
tgtcccacaggtctctttgagcctggagacatgaaatacgagatccaccgagactccaca
EXON 8  135 bp
cactgagctcatgcaggcttccctggacccgtctgtgacccatctcatgggtaatgaccc
ccttcctgccctggcatccctcagatggcctcagatggcaccttctgagcctgtgtgcac
atccgccagcacccgcccacccccagcctgccagtcaccacaggaccccttgtcccacag
GTCTCTTTGAGCCTGGAGACATGAAATACGAGATCCACCGAGACTCCACACTGGACCCCT
CCCTGATGGAGATGACAGAGGCTGCCCTGCGCCTGCTGAGCAGGAACCCCCGCGGCTTCT
TCCTCTTCGTGGAGG
gtgcgtggtggcccctggggagtgggggttgggggttggagcagggcaggctcagcatct
cccccctctggccttcctgcaggtggtcgcatcgaccatggtcatcatgaaagcagggct
taccgggcactgactgagacgatcatgttcgacgacgccattgagagggcgggccagctc
EXON 9  192 bp
ccgagactccacactggacccctccctgatggagatgacagaggctgccctgcgcctgct
gagcaggaacccccgcggcttcttcctcttcgtggagggtgcgtggtggcccctggggag
tgggggttgggggttggagcagggcaggctcagcatctcccccctctggccttcctgcag
GTGGTCGCATCGACCATGGTCATCATGAAAGCAGGGCTTACCGGGCACTGACTGAGACGA
TCATGTTCGACGACGCCATTGAGAGGGCGGGCCAGCTCACCAGCGAGGAGGACACGCTGA
GCCTCGTCACTGCCGACCACTCCCACGTCTTCTCCTTCGGAGGCTACCCCCTGCGAGGGA
GCTCCATCTTCG
gtaggcctggggagagtggcaggtgctgctgcagcaattaagtgggtgaaatctgagcct
cagtctcctcctctgtcaaatgggagtaatgctggcaccagccctgtagggtctcctgag
gactaagcccctgaccaggcaaaacgtggcggtgcctagcacgtgggagacactccacag
EXON 10  117 bp
aagtgggtgaaatctgagcctcagtctcctcctctgtcaaatgggagtaatgctggcacc
agccctgtagggtctcctgaggactaagcccctgaccaggcaaaacgtggcggtgcctag
cacgtgggagacactccacagctgtgttcagctcaaccacagggacccctctctctgcag
GGCTGGCCCCTGGCAAGGCCCGGGACAGGAAGGCCTACACGGTCCTCCTATACGGAAACG
GTCCAGGCTATGTGCTCAAGGACGGCGCCCGGCCGGATGTTACCGAGAGCGAGAGCG
gtgagtgccgcggggtggccccctgagggggaccagggtgccaaggatggggggctggcg
ggaaggggtcacctcctgtctgcctggaactgaatgaaccctcctaccggaactgaaccc
tccaaccagggagccccgagtatcggcagcagtcagcagtgcccctggacgaagagaccc
EXON 11  1386 bp
gctatgtgctcaaggacggcgcccggccggatgttaccgagagcgagagcggtgagtgcc
gcggggtggccccctgagggggaccagggtgccaaggatggggggctggcgggaaggggt
cacctcctgtctgcctggaactgaatgaaccctcctaccggaactgaaccctccaaccag
GGAGCCCCGAGTATCGGCAGCAGTCAGCAGTGCCCCTGGACGAAGAGACCCACGCAGGCG
AGGACGTGGCGGTGTTCGCGCGCGGCCCGCAGGCGCACCTGGTTCACGGCGTGCAGGAGC
AGACCTTCATAGCGCACGTCATGGCCTTCGCCGCCTGCCTGGAGCCCTACACCGCCTGCG
ACCTGGCGCCCCCCGCCGGCACCACCGACGCCGCGCACCCGGGGCGGTCCGTGGTCCCCG
CGTTGCTTCCTCTGCTGGCCGGGACCCTGCTGCTGCTGGAGACGGCCACTGCTCCCTGAG
TGTCCCGTCCCTGGGGCTCCTGCTTCCCCATCCCGGAGTTCTCCTGCTCCCCACCTCCTG
TCGTCCTGCCTGGCCTCCAGCCCGAGTCGTCATCCCCGGAGTCCCTATACAGAGGTCCTG
CCATGGAACCTTCCCCTCCCCGTGCGCTCTGGGGACTGAGCCCATGACACCAAACCTGCC
CCTTGGCTGCTCTCGGACTCCCTACCCCAACCCCAGGGACTGCAGGTTGTGCCCTGTGGC
TGCCTGCACCCCAGGAAAGGAGGGGGCTCAGGCCATCCAGCCACCACCTACAGCCCAGTG
GGTACCAGGCAGGCTCCCTTCCTGGGGAAAAGAAGCACCCAGACCCCGCGCCCCGCTGAT
CTTTGCTTCAGTCCTTGAATCACCTGTGGGACTTGAGGACTCGGGATCTTCAGGACGCCT
GGAGAAGGGTGGTTTCCTGCCACCCTGCTGGCCAAGGAGGCTCCTGGGGTGGGGATCACC
AGGGGGATTTTGACACAGCCTTCGGCTGCCCCCCACTAAGCTAATTCCACACCCCTGTAC
CCCCCCAGGGGGCCCTCTGCCTCATGGCAAAGGCTTGCCCCAAATCTCAACTTCTCAGAC
GTTCCATACCCCCACATGCCAATTTCAGCACCCAACTGAGATCCGAGGAGCTCCTGGGAA
GCCCTGGGTGCAGGACACTGGTCGAGAGCCAAAGGTCCCTCCCCAGACATCTGGACACTG
GGCATAGATTTCTCAAGAAGGAAGACTCCCCTGCCTCCCCAGGGCCTCTGCTCTCCTGGG
AGACAAAGCAATAATAAAAGGAAGTGTTTGTAATCCCAGCACTTTGGGAGGCCGAGGTGG
GCGGATCACGAGGTCAGGAGATGGAGACCATCCTGGCTAACACGGTGAAACCCCTTATCT
ATGCGCCTGTAGTCCCAGCTACCCAGGAGGCTGAAGCAGGATAATCGCTTGAACCCGGGC
GGCGGAGATTGCAGTGAGCCGAGGTCATGCCACTGCACTGCAGCCTGGGCGACAGAGCGA
GATTCTGCCTCAAAAATAAACAAATAAATTTTAAAAATAAATAAATAATAAAAGGAAGTG
TTAGAC
aatgtaatgccagtactacttcctaggaggaaaatcatgagtgcctgtgggcacagtgtc
tggaggggtggataacgcaggccaggaggggctgctgaggagcagatgattgagcaggag
acctaaacagagtggggcttgagcaaggcagaacagcagtgccaaggccctggggcagcg