Gene AGPS Variant 1
DNA : 145.50 KbNT_005403
mRNA : 2074 bp NM_003659
CDS : 1977 bp NP_003650
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  275 bp
ccgaggcgtgacaagggagcgccggcgcggtgggtggggggcagagaatgtgaagctcca
gacgcatggcacccgccgccaagtcgccgcggtggctgccgggatgcgccgcagcgaatg
gtcgcgccgggcgccgctctgagtgacctttcacccgcgcccagcggttccgggcggcag
CACAAGGCGGTAGCCATGGCGGAGGCGGCGGCTGCAGCGGGTGGGACTGGCTTGGGCGCG
GGCGCGAGCTACGGGTCTGCAGCGGACCGGGACCGGGACCCGGACCCGGACCGCGCCGGG
CGGAGGCTGCGGGTTCTCTCTGGCCATCTGCTGGGCCGGCCCCGGGAGGCTCTGAGTACC
AATGAGTGCAAAGCGCGGAGAGCCGCGTCGGCGGCCACGGCAGCGCCCACGGCCACTCCC
GCCGCGCAGGAGTCGGGCACCATCCCAAAGAAGCG
gtgagtagcggtatgtggaaggagttagcgtcgagggaccaggccgggcctgtgctgcag
gagggcacaggcgaggtgggaagggaagtgacacgggtgggcggaaggcatcccggtccc
tgaaagtagggacccacctctctttcgagagagtggactagaccctggattctgtcagga
EXON 2  90 bp
ttctatattcagaaatattagtatatggacattttaatgtgtgctaattttatttaacct
tatacaatatttgtgggcataaggtattttagatgattgtgagttaataatcaatgatat
actgtacagttttaagatgtttagcattggtctcacttatatatattttcttctcactag
GCAAGAAGTTATGAAATGGAATGGATGGGGATATAATGATTCTAAATTCATCTTCAATAA
GAAGGGCCAAATTGAATTGACTGGGAAAAG
gtaaccctggtttatttcttcttttgttcctcctttaattctttctttctatgaaaaatt
ttaaacacacatgaaaatataatgattcctccttgagtttaaacattatcaacattttgc
cataactgctttttgtctcctggtaatatttcaaattctgatgttgtcatgtcacctcta
EXON 3  91 bp
tgtctatactgcctttagatagctgggttttgtttgttttgttttcgttcagagtttata
gttacatgtgaaagtgttggtttgatagtagctgcttgaccatcactggaagcagaattt
aagctttaaatttaaatgaagatactttgctctaatatttttactttctttgtaccttag
GTACCCTCTTAGTGGCATGGGTTTACCAACATTTAAAGAATGGATCCAAAATACCCTTGG
AGTAAATGTGGAGCATAAAACTACCTCTAAA
gtaagcaaacaaaaattattactaactcatttaactgtgtttttaaaacccaaattaatt
tgatttatctttgtaattcattatattggatttactgcaactgtcatgttttttgttata
aagcctattaattatattggccttgttagactgttagcggcagttattcattgtcacaga
EXON 4  121 bp
tttgtaatttgttactctcataaagctgatttctatatatgttgtgttgtattttcctat
gcttcagccttactttgaatgtttaaaaaaaagtctacattttatagtcattctctctaa
ctgaagtacccaaaattcgttgtctaaaaataagtcaaagaaatcaattttattttctag
GCATCCTTAAATCCTAGTGATACACCTCCTTCTGTTGTAAATGAAGATTTTCTTCATGAC
CTTAAAGAAACTAATATTTCATATTCACAAGAGGCAGATGATCGAGTATTTAGAGCTCAT
G
gtaagttactttatattagccctatttatttttaacaaaaaaattctatattttaagctg
tttttgtgtttttcttttttttaaccacaaaacaggtcattgtcttcatgagatattttt
gctcagggaaggaatgtttgagcgaattcctgatatagttttatggccaagtaagttttc
EXON 5  75 bp
gtaaatgaagattttcttcatgaccttaaagaaactaatatttcatattcacaagaggca
gatgatcgagtatttagagctcatggtaagttactttatattagccctatttatttttaa
caaaaaaattctatattttaagctgtttttgtgtttttcttttttttaaccacaaaacag
GTCATTGTCTTCATGAGATATTTTTGCTCAGGGAAGGAATGTTTGAGCGAATTCCTGATA
TAGTTTTATGGCCAA
gtaagttttcccctcctcgtatcattaatttagtattgctaaattttaggtaaatttaac
attggaaatacgtactttttggcatatgagttgtaaaaaatataaattgctgtattttta
agagagtttacataacagtcttgaagctctttcttgacttggttgttctgaactattggt
EXON 6  72 bp
ttatttcaaaatgaaaagttaaaaaggtaaagtgttttagtactcaattaactcattgtg
ttaatgagcaaatgaatgaaggaaaagtttagataaagaatttcgtaggttcttatttgc
caaggttatcagattttatttatgcctctgtaattaatttattttcccttttttcaacag
CATGCCATGATGATGTAGTTAAGATTGTGAATCTAGCTTGCAAATATAATCTTTGTATCA
TACCAATTGGTG
gtaggtattgtgccttttgaattttaatatgtaaatttgttctatttaaaatatttgtat
tttaaatatttgcgtcaccctactgaaaacaaacattattgtaattgtgatgtggttatt
ctcaaaaattggtcaatgatgctcatttttgttctaagtaggattccttaaactgtttga
EXON 7  80 bp
aaaataaaggtgagtttgcttttagtgtgttagcatttgcaagttgtattttgcaaagta
ttaataggtatcacttttctagtggccctatctgtatacttgatatgagggatttgccat
agaaatatagctaaaaacagaatatttaaacataaaagttgttgtttcctattttggcag
GAGGAACAAGTGTTTCATATGGCCTGATGTGTCCTGCAGATGAGACAAGAACAATTATTT
CTTTGGACACTTCACAAATG
gtatttaataatttgagatatatttaaaacattttctttattggctccaccttaattgtc
attaaaaaagaatctagccactgggcgctgtggctcacgcttgtaatcccagcacctggg
gaggctgaggtgggtggatcacttgaggtcgggagttcgagaccagccaggccaacatag
EXON 8  81 bp
tatgttgtcatgttgtatagtctgggataagtggacttggtttccagtgtgggtggttga
ggggaacccttcttgcttaatcactgtcttaccacttgttgctttgaattaggaagttat
atttcctgagaaaatattagtagttcctggagatcagatttctttcttcctttgcaacag
AATCGAATTCTCTGGGTTGATGAGAACAATTTGACAGCTCATGTAGAGGCTGGCATAACA
GGACAAGAGTTGGAAAGACAG
gtatgttatttatttttcttatttttttaaattaacttattctaatatcaattctgatgt
tatttctttaatgaaagttttcaaaactgtatcccctctatgaatgaaataccttttatg
atacattcattcactcaaagaatttgtttagtttctattatgggtcaagcattgagctag
EXON 9  126 bp
taaaaaaatttttaggactagtgtgataaaagtatcttttttttttttttttgctatgta
ggaattaataaattcaaatatcaatgacatggaaattttaaagtgggaggagttaatgtg
ttgagtgctgtacgtaatgggaccattttcactgtaaaatgttaaatttttgtttttcag
CTTAAAGAAAGTGGTTATTGTACAGGTCATGAACCAGATTCCCTGGAGTTCAGTACTGTA
GGAGGATGGGTATCTACTCGCGCATCAGGCATGAAGAAGAATATCTATGGCAATATCGAG
GACCTG
gtaaatatttttctagttattatgtaataattgattagtatatagatattattataaaat
gattagaagcctttaaaaattaagagttgggcctgggcgcggtggccaatgcctgtaatc
ccagcactttgggaggccgaggcgggcggatcatgaggtcaggagatcgagaccatcctg
EXON 10  109 bp
caaatttaactttagtctaaaaattactaaaagatactagaattcttaaaagcatcacaa
tttattacttaacccaatactttaaaagtaggttttacataaatatatataaatgtctgt
acatagacacacattcactaacagatgtctagaatttacatcgtgtattgtattaaacag
GTGGTTCATATAAAAATGGTAACACCTAGAGGTATAATAGAAAAAAGCTGTCAAGGACCT
CGTATGTCAACAGGCCCTGATATCCATCACTTCATCATGGGATCTGAAG
gtaaatataactgtaaatttattaagaaaaaatacaggttagtcatgcagttttgtgaaa
atctttatattgtgacatcagatctttgaaagacatgttttatatgtttaaggaattttt
taaatttttatcattttaagactataaagttttattatgagaacatctgattaaacttcc
EXON 11  128 bp
tgtaaaatttgcttaattttataattttttctagaatgacttgagtagccattattcccc
aggtagacttgataaatttaaatgtgcataataaattgaattaatagattaaatagattt
aaatatgatttagaaaattgtcatgtgatgtactggattattcccccttctttttttcag
GAACTCTTGGTGTAATAACAGAAGCTACAATAAAAATCAGACCAGTCCCTGAATACCAAA
AGTATGGCTCAGTAGCTTTCCCTAATTTTGAACAAGGAGTAGCCTGTTTAAGAGAAATTG
CAAAACAG
gtaaaagaaaaaatatatatatatacatacatacatatatgtttatgtatttatattttt
caaattctactacatagttgattgtgatatgttacaactaatcttcatttttagttgtat
tatatttgtggtttttacccagttctatatgaaaaggtagtgttgtacagtcatccttta
EXON 12  52 bp
tagaagtcattgatatttgtcttcataaaagtatatgaaaagttaactttttttcctctg
taaatccttaggaactaagctcttgatctcttaaatatagaaagataatattcacattct
acctgtctagcttcttactgtattaaatttgtatcacttttttttttctttttaaaacag
AGATGTGCTCCGGCATCTATTCGCCTCATGGACAACAAGCAGTTTCAGTTTG
gtaagtaaggagtggtaattttaaaatgtcatttagccacagaaatttatgaaacatcag
taggaagagtacggagtgcagaggtagaaagaacgtcagtcttgcctttcaggaagatgt
cagtctaatgaagatagacaattacataaatgagtgagggtagcagtgttggagggcctg
EXON 13  77 bp
gcaaatattaatataactatatatcgtaatataaatatttatgtaaataacacgggaaga
ttttaaaaattaaagttgtgaaaacttttactttcttttaggattctaagttggagtagc
ttcttgatcttctgaaaaacatagactaacctattaatataaacttttttctcttcttag
GTCATGCTCTTAAACCTCAGGTTTCCTCTATTTTTACATCATTTTTGGACGGATTAAAAA
AGTTTTATATTACAAAG
gtaagaatttttataaaatgctaaaattgtaaatgcttaagatatctgttttctgctttc
ttcccacatgcacctattgtaagggtgtttttccatgttgctatgtacatttcagaatta
cagtttttcatgttggaataaatattaagtaaatcaggcagtcaatttcagaaaatttta
EXON 14  113 bp
aatgacctaaataggtttattaaacattcttagtgattgacatgtaaagttccaaagctc
aatttttaagaaatcagtgtatttgagcccagatcagaaggaaaagagcaaaatgtattt
tgatttattgttttgtaggataagacttatctgtaataataaatttttttttttttgtag
TTTAAAGGATTTGACCCAAATCAGCTAAGTGTAGCCACATTACTGTTTGAGGGGGATCGT
GAGAAGGTTCTTCAACATGAAAAACAAGTGTATGATATTGCTGCAAAATTTGG
gtatggcttcaagttcataatgccaagagaaagagttaaaagctaagattctaatatcac
caagcaattattaaagtactaggcattaatgtctccaaacagactgcatgtctcaaagta
gttattaatttcagtttagtgttaaatttgtggtaatttatgatagtaaacttaaaatat
EXON 15  70 bp
tgagtttatgagtcaattttatttcgtggataaaagtttgaaattaagatgaaacagaaa
tattaaaagtgttttcagatttttgttattcaaacttattctcttgacagctttttgata
catttatgataaatgagattaagataaaaaatttattaacagtttgttctttaattacag
TGGGTTGGCAGCTGGAGAAGATAATGGACAGAGAGGTTATTTGCTGACCTATGTTATTGC
ATACATTCGA
gtaagttatatcatatttcccttgccacttaatttatgttgcaaacaatactttttctta
ctttaagtgaatgcaattgtcttccctattttttaaaattttaagctactgtaatttagc
atatcattttacatgaaccttattttagctacaaatcttcagaagcccatttaaaccttc
EXON 16  62 bp
cggaggctgcatctcactccagggacaacttttcagtgctcttatgaggtggatagtaaa
gagtggatgaagttaaatgagaaacatgtgatactaacaatgaatatgaaagactaacag
tgttattgattcttctgcatctgttgtagtttcttgatttttctgtttgtgtcttaatag
GACTTGGCTTTGGAATACTATGTATTAGGAGAATCTTTTGAGACTTCTGCTCCTTGGGAC
AG
gtaaaatatactaaagtgcctgatattattcaaatatgcgatatgaattgcttgaagtaa
tgtttctttttgtgtgaatatgtaagtttaaaacattttatgaagaaacattgagacaag
gcagctactttatttaaattaatatattcatcagaatgccgtattttcaagtgttttatt
EXON 17  90 bp
ttaggaatggagggctcaatttgagtgatcagggctcttttccattcttgaaaggacaac
tatgaaagctttagctaagaaaatgtcagacttgaatgatgccagattaaccaacgttta
ttagcacttgtgtagttctcacttgaaaacttaatattgtattcatttatctttttttag
GGTGGTAGATCTCTGTAGAAATGTAAAAGAAAGAATAACAAGGGAATGCAAAGAGAAGGG
TGTTCAGTTTGCTCCTTTTTCTACATGCAG
gtaagttttaaaaattgttcttatacttcttattctgaaaaaaatgttttttttaatcaa
gggggggaatataattttccagctgagaaaaagcttcagtctattacatttggccagctt
tcctaaccttcacttaccaccttgttaggattgtgccactggaattttacagtagtcctg
EXON 18  100 bp
gttttggcggacaactctaaagcaagccaatgtgtattccttccatggagtagaggctgg
gaagaaactgagattatatcttaaactaatcatttgggtcgtcttgactttcagtttcta
gatgttaaatctgatttcacttaacttaaagcccctgtggggattttgtttgttttttag
GGTGACGCAGACTTACGATGCAGGTGCTTGTATCTACTTCTATTTTGCCTTTAACTACAG
GGGAATTAGTGACCCACTGACCGTATTTGAACAAACTGAG
gtaattttgcatacctgcatatagcttttacagctgttgattaatttcaataaattttac
tgtcaatttatgaattttaagttgagtctctttaatcacacatggtttgcctagctgtta
gcccttagaaatgaaaagcatatttgtttccctggcttatgtactgaattgtgagtctaa
EXON 19  58 bp
aagctaggctacttatttaattgctttttaaacacatttgaccaaaagagaggaaagtta
ggcttctagtttattatttaacccaggaaacatgtgccttctttgggagttgggtctttt
tctttcactgcaaaatgaaatctaactagcaacaatttgttgtgttgtttccaaatacag
GCAGCTGCTAGAGAAGAAATCCTTGCTAATGGAGGGAGCCTGTCACATCACCATGGAG
gtattcttttttgggagtagaatttctaatattcttactttaaaaaatattcagttcagt
aaaatgctagggagagacatggtatgaataatatgagagtacttgaggtttctttaaagt
ttctatgtctttgaaatagctgttactgaggtagatagttaggttgtggtagtagccact
EXON 20  204 bp
atacattgggcttaatgagcttgatagtctggtgggctcaataaatcaaataaagcaaaa
catttctcatttttgaataaaagcatttatcacacagtgtttgttcactcatggtcacaa
gattgattggttcccagtatcatagcatatattgaagcatttttgattttgtttttccag
TGGGCAAGTTACGGAAGCAATGGCTAAAGGAAAGTATCTCTGATGTCGGCTTTGGGATGC
TGAAGTCTGTCAAGGAATATGTGGACCCCAATAACATCTTTGGAAACAGAAACCTTTTAT
AAATCCATTAGTACCATTACAAAAAAATGTCAATTTTTTTTTTAAGTTTTCAACTGTGGT
TATACTAGTAATCAAATATATCAT
ggactatattttggatacatttgtttctttggtttaaaataagtttgttttcattctgta
gtttgttttgtttctacatctatggattgacagatagtattcctaaatctctctcattgt
aggtacatcattttacattcagcggttgtcatttcaaattttagtcaggcagcacaaagc