Gene ADRA2B Variant 1
DNA : 3.27 KbNT_026970
mRNA : 3266 bp NM_000682
CDS : 1344 bp NP_000673
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  3266 bp
ggcggctgctggtcctgggtgttcccgacctcctaggccccgctcgtccaggccatgggg
ctccagcgccctcggcgccgcccgaggggcgacgctcttgtctagccgagccgggcagcg
ctgtcgtccacggtgcgcactgggcgggcagcgctccctctgcccacctcccgccccgtc
ATGGACCACCAGGACCCCTACTCCGTGCAGGCCACAGCGGCCATAGCGGCGGCCATCACC
TTCCTCATTCTCTTTACCATCTTCGGCAACGCTCTGGTCATCCTGGCTGTGTTGACCAGC
CGCTCGCTGCGCGCCCCTCAGAACCTGTTCCTGGTGTCGCTGGCCGCCGCCGACATCCTG
GTGGCCACGCTCATCATCCCTTTCTCGCTGGCCAACGAGCTGCTGGGCTACTGGTACTTC
CGGCGCACGTGGTGCGAGGTGTACCTGGCGCTCGACGTGCTCTTCTGCACCTCGTCCATC
GTGCACCTGTGCGCCATCAGCCTGGACCGCTACTGGGCCGTGAGCCGCGCGCTGGAGTAC
AACTCCAAGCGCACCCCGCGCCGCATCAAGTGCATCATCCTCACTGTGTGGCTCATCGCC
GCCGTCATCTCGCTGCCGCCCCTCATCTACAAGGGCGACCAGGGCCCCCAGCCGCGCGGG
CGCCCCCAGTGCAAGCTCAACCAGGAGGCCTGGTACATCCTGGCCTCCAGCATCGGATCT
TTCTTTGCTCCTTGCCTCATCATGATCCTTGTCTACCTGCGCATCTACCTGATCGCCAAA
CGCAGCAACCGCAGAGGTCCCAGGGCCAAGGGGGGGCCTGGGCAGGGTGAGTCCAAGCAG
CCCCGACCCGACCATGGTGGGGCTTTGGCCTCAGCCAAACTGCCAGCCCTGGCCTCTGTG
GCTTCTGCCAGAGAGGTCAACGGACACTCGAAGTCCACTGGGGAGAAGGAGGAGGGGGAG
ACCCCTGAAGATACTGGGACCCGGGCCTTGCCACCCAGTTGGGCTGCCCTTCCCAACTCA
GGCCAGGGCCAGAAGGAGGGTGTTTGTGGGGCATCTCCAGAGGATGAAGCTGAAGAGGAG
GAGGAGGAGGAGGAAGAGTGTGAACCCCAGGCAGTGCCAGTGTCTCCGGCCTCAGCTTGC
AGCCCCCCGCTGCAGCAGCCACAGGGCTCCCGGGTGCTGGCCACCCTACGTGGCCAGGTG
CTCCTGGGCAGGGGCGTGGGTGCTATAGGTGGGCAGTGGTGGCGTCGACGGGCGCAGCTG
ACCCGGGAGAAGCGCTTCACCTTCGTGCTGGCTGTGGTCATTGGCGTTTTTGTGCTCTGC
TGGTTCCCCTTCTTCTTCAGCTACAGCCTGGGAGCCATCTGCCCGAAGCACTGCAAGGTG
CCCCATGGCCTCTTCCAGTTCTTCTTCTGGATCGGCTACTGCAACAGCTCACTGAACCCT
GTTATCTACACCATCTTCAACCAGGACTTCCGCCGTGCCTTCCGGAGGATCCTGTGCCGC
CCGTGGACCCAGACGGCCTGGTGAGCCCGCCTGCGCTGCCCCTGTGGGGTTGGTGCGGTG
GCGCCGGGGTCACCCTGCTTCTTGCCCTGCTGTGTGTGGCTGCCTCCCCTGGGCTTTCTG
CTCCCTGCCCAGATCCTGTAGGCCTCATCTTAGGAACCCCTTGGGAGGGGTGGGCAGGGG
GGCTGCTAGCAAGGGTCCCAGTGAAGCTTCCCCTTGCCGGCTTAGCTGTGGGGGACCCCT
TCTCCACCCTCTCCCTGAGCACAGGCCGATGGAGGTGGTTCAAATCCTCTGGAACATAGC
CAAGACCAGGAGAAGAGAGAGCACTTTCTTCCCAGAGCCCCATGCTCTCCAGACCAATGT
CTGGGCTTCCCTTTCTTGAGGACCTTGTGTTCCTGGCAGGTCACTTGCTTGTGGTGTTTT
CGTTTCTTTTTCATCTCCCCCCCACCCACAAAGAGCACGGAGCCAGCCTTCCACTTTTCC
CAGTGGGGCCTGCTGCTGAGGGGGAGGAAGAAACGAAGACTGATCACCCACGCTAGGCAC
TCGCGGTCCCTGGCAGGCGCTGGGATGGGGGCTTATGGGGTGGCATCGTCTCTGGGCCCT
CCTTTCCCCCTTTGCCTGTTTTCGGATCTGTGGTTCCTTTGAAAGCCAGAACAATGGATC
GGCTTCCTTACCCAGCACCCCTCCGGTAGGTGGGTGGCCACGTGGATGCCTCGCTGGGGC
GGTCTTGGAGGCCTGGTCTCTGCCTCGACGGGAGATCCCCGATCACTGGCATTCACCCCC
TGCAAAAATCGGGGCGACAATAGCTCACTGCCTACTTGCTGCAGGGAGATGAAAGGCTTT
GCAGAAAGCTTTGAGCTCTGTGGGGGAACACACTAGAGAACCAAAAATGTGATTATATGG
TGATATAAAAATCCCTTTCCTCTGTGTTTACCACCACCTGTCTTCCTGTAGACTTTTGTT
CTGTCCCTGGGGTGTGTGAATTCCTACCCCGAACTGGAAGCCGGGAGTGGCAGACAGAAT
CACTATTTCAAGTTAAAGGATCTCTTTGAGAATGTGTTCTTCTGGCTGCAAAGGTCTGAG
TTATTACGCTACATGACAACGTTTCGACATTTCACCGGCAACACCAAGAGGGTTTTTAGT
GGCTTGGGTCTCCCCAGTGGGGGATAAGTCTTTTGTCATCAAGGAGGCAAATTGTCTCCC
CAAGACAGCTCAAAATATCCACACCTCGGCAACAGTCTAAGATGAGAGCCTGTGACAGGT
GGCAGCGCCCCCAGGTGGGGTACTGGCATCAGAGCCTGGTGCGCCCCTAGGGGAGCCTCC
CACTGGAGTGCCCGGCCAGGTCTCCAAGCCCCAAATGAGTCCTTGTGAACCACAACTGAT
CCCCCCAGGTGGGTGCTTGTGGACTGCCTCGGACCCAGCCACGCTGCTCCCCGCAATGCT
GATGGGGCTGTGCATTGAGGACCCCTGCTTCCTGGTTCTCAGTCCCACCCCAAAACCTGG
CACCCAGAACAGTTGGAAGTGTGGAAAGGAGGTTTATCGGCCTTCCCTTGGAGAGGGCCT
GGCTTCAACATTGGGCCAGTAGGCATCTTAGCTTGGCAGGTGTCGGGGGAATGGGCCAGA
TGGACCTGCTAGATTTGGAAGGGCACCGAGGGAGTTTTCTGGGTGTAGAGAGAATGGAGG
GGACCAAAAAGAGTCCTTCCTGGGGTGTGGGAGGCTTCCCAGCTTGGTCCTCAGTGGGTT
GTTGAGGCCAGAGTATCGCCCTGGGATGTGGTGGGGAGCTGGGCCAGGAGAGGGACTGAC
TGTGACCCTCTGCTGGCCGGTCTTGTGTGCGCCCCATGGGACCCCCAGTGTTCTTGCCTG
TGACCTCTTATTGCGACATGCAGGTGGTGTTTTTTTTTTTTTTAAACTCTGAGCTATTTT
ATCAATAAAGGATATTTTGTAATAAG
taagtggtgtccttgttgcccaaaggctgcctggagcagttattcctcagctgctggcac
agcagactctgggtgctggcctaatgacctggggctccctcccagggccagtagtcctct
cctccccgagatgtggctggctggttcccccaagcccctgcccttcctacccgcctttgt