Gene ACTR2 Variant 1
DNA : 42.32 KbNT_022184
mRNA : 2682 bp NM_005722
CDS : 1185 bp NP_005713
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  117 bp
gggaggggcctcgacgctcctccatcttttattggagctcaccgctgccagtcgcgctgc
ctgcccgtcccacccttttcgtgcaggcattcagctaaatgacgggcggagcccggcggc
ggcttccggtcgggggaaaaaagttgggccgaaggaggggccgggaagacgcaagaggaa
GAAGAGAAAACGGCCGGGCGGCGGTGGCTGTAGGTTGTGCGGCTGCAGCGGCTCTTCCCT
GGGCGGACGATGGACAGCCAGGGCAGGAAGGTGGTGGTGTGCGACAACGGCACCGGG
gtaagggccgcgcgaggaggccttggcggccacagacgccggcggggacgagcagctggc
gcacgggccctcggcccccagggctgcacctccgggccctcggggcgaaggggcgcgggg
cggtgcctcccacctccgcgggcgtgggagcgagccggccgttccctggtctcccttgag
EXON 2  111 bp
atgccgtgaaagaagttaaaaggagatgttgcgatagattgagtggctacttcgggtgga
ctgaaagcaccaaaagtttaaaatgttatataaatgcaaagtgatatttttcagatgctg
tcttaaaatatagtaaatatcctgatgctaacccacttttattttactgtttcattccag
TTTGTGAAGTGTGGATATGCAGGCTCTAACTTTCCAGAACACATCTTCCCAGCTTTGGTT
GGAAGACCTATTATCAGATCAACCACCAAAGTGGGAAACATTGAAATCAAG
gtaatattttatttattgataaatgataatcaagacatgtgaggtgttcttataaaagta
gtttaacagttcttttaagtagttttaaaatatgttgccatgaaaagcaaaggggagggt
agaagttctcatatttttaatttatatcaacacctgaacaggggcacaaaaattgaagtt
EXON 3  216 bp
taaaaatgtattatccatgattaaactttctaagacattgttcttgatagaaaagatttt
ctaacttgtggaataaaaagatttattttgcaagtgtcagaaatattaaaattaattatt
cccaagttttcttaaatattatgcaaaactttgatctacagctttgacataattttctag
GATCTTATGGTTGGTGATGAGGCAAGTGAATTACGATCAATGTTAGAAGTTAACTACCCT
ATGGAAAATGGCATAGTACGAAATTGGGATGACATGAAACACCTGTGGGACTACACATTT
GGACCAGAGAAACTTAATATAGATACCAGAAATTGTAAAATCTTACTCACAGAACCTCCT
ATGAACCCAACCAAAAACAGAGAGAAGATTGTAGAG
gtgagtttttatgcaggatatgcatatgtgtatttctgtgatattatgttaaatcaaaaa
ttttcttactgttgctatggataaagagaataaaaataattgttttccttcagatcttat
taagtatctactatatgctagtcattattctaagtaggaaagtaggatagatcagtaaac
EXON 4  73 bp
gagctctgtggcagcaggacttcaataagaaataagaggagctgatgaaaatggaagact
atttcaggtccatttgattctattttgggcaattaattcactctgtgaccatgaggaaaa
catttatttattatgtaattttctaaataccagtttttttctttctgtctgcatttacag
GTAATGTTTGAAACTTACCAGTTTTCCGGTGTATATGTAGCCATCCAGGCAGTTCTGACT
TTGTACGCTCAAG
gtaggttaagcttaactgttagaaaaaacacttcatcaaacatttattatgtatgtttta
tgtcagagaatttggtttctcaataagttataagccccagaaaactacattatttatata
ccacactttgaaatattttcagtttttaaaatttgtgaaataagattttatatacatttt
EXON 5  137 bp
aaaagagaacactcgctttaatacttatgcattagaaacaaactgcaaaataactaaata
ataaattctggcttctagttggttacgtttctgttttggcttccctactgtatttggaac
tcgctggctttggttttcctgatttgactttttatttaaatccccctggcttttatgcag
GTTTATTGACTGGTGTAGTGGTAGACTCTGGAGATGGTGTGACTCACATTTGCCCAGTAT
ATGAAGGCTTTTCTCTCCCTCATCTTACCAGGAGACTGGATATTGCTGGGAGGGATATAA
CTAGATATCTTATCAAG
gtaagtgaaaggaaaatatcatggaaattaaattttgtaatttgtttaccaccttaacac
agaattgaatctatcgttttaggattccagcaaatctgtaccactagagaaattatccaa
ttacctcccttatttatataaaaattcatataagatttatacacatgaagaaaaaagaag
EXON 6  150 bp
aaactgaaatataaatccttttatggcggataaaatcctgcttctgaaatagtaggagct
gaggatccactgcccattctgtttgttattgatgtgacatatttaatgagcattactagc
ttttgcagagtagaactcattcagatgtattatgaacttattgctattgttttgtaccag
CTACTTCTGTTGCGAGGATACGCCTTCAACCACTCTGCTGATTTTGAAACGGTTCGCATG
ATTAAAGAAAAACTGTGTTACGTGGGATATAATATTGAGCAAGAGCAGAAACTGGCCTTA
GAAACCACAGTATTAGTTGAATCTTATACA
gtaagtgtttccagtgtataatatatatgtgttttaaagtggacagccatgattattggt
gtcagcttaaggaggttttcttagaatcagtatttttgtcttgggttgttgtaatatgta
tatgtgtgacttttaatgtctctttctacattaagtttctatttaattattttagggcac
EXON 7  146 bp
agagcagttacctaaatctatttaatttacctttttttccccaaatatattttaggaaaa
attgttgttggtaatgattttggttacagaacagatgtatttataagtactagtgttccg
gagaacactgggaaattttaatcttttgctgattagtacctgattattcttggtttctag
CTCCCAGATGGACGTATCATCAAAGTTGGGGGAGAGAGATTTGAAGCACCAGAAGCTTTA
TTTCAGCCTCACTTGATCAATGTTGAAGGAGTTGGTGTTGCTGAATTGCTTTTTAACACA
ATTCAGGCAGCTGACATTGATACCAG
gtacattagaagtggtgatttcaaagttatttatcagaaaaatcataaaaatagttttaa
agttatttatcagaaatagatggaattaaatagaatgactaagtttataaacttacttga
aataatttcagacttacggaaaggttgcaagaaaaatgcagaaaacttatctgtatcctt
EXON 8  133 bp
atgtaaagaggggtcgttacttcacagtagtaataacagcaaatattcagccctgtgatt
tacatgtggaattttatttaattctcccagcaaccccgaggctgacataagtaacagtaa
ccctgagataccattttcctaacctaaaactccaaatgaataaccattgtgcctttctag
ATCTGAATTCTACAAACACATTGTGCTTTCTGGAGGGTCTACTATGTATCCTGGCCTGCC
ATCACGGTTGGAACGAGAACTTAAACAGCTTTACTTAGAACGAGTTTTGAAGGGTGATGT
GGAAAAACTTTCT
gtaagtattagtaaatcaactattactaacattcttttaaaaggctatacagtagtttgt
gaatcttgacaaccaccagagggagcaagacgtcttccaaaacaaattcctactgcagtc
aagtgcatcctggaaatgatagcaagaaggaaatagttcaagataagctctggtcacctc
EXON 9  1599 bp
aacatgagctttgggcaaattactaaatgtttctgtacctcaggtaccaaatattacgtt
ctacttatattacaggactgttgcaagtttgagggagagcatatatttaaaaagccattt
tcataaagcagaaagcactgtgcacatgtaccatttcattatcctttctttctcctttag
AAATTTAAGATCCGCATTGAAGACCCACCCCGCAGAAAGCACATGGTATTCCTGGGTGGT
GCAGTTCTAGCGGATATCATGAAAGACAAAGACAACTTTTGGATGACCCGACAAGAGTAC
CAAGAAAAGGGTGTCCGTGTGCTAGAGAAACTTGGTGTGACTGTTCGATAAACTCCAAAG
CTTGTTCCCGTCATACCCGTAATGCTTTCTTTTTTCCTTTATTGCCAATCTTTGAACTCA
TTCAACTCCAGGACATGGAAGAGGCCTCTCTCTGCCCTTTGACTGGAAAGGTCAAGTTTT
ATTCTGGTGTCTTGGGGAAGCTTTGTTAAATTTTTGTTAATGTGGGTAAATCTGAGTTTA
ATTCAACTGCTTCCCTACATAGACTAGAGGGCTAAGGATTCTGTCTGCTGCTTTGTTTCT
TCTAAGTAGGCATTTAGATCATTCCTATAGGCTTCCTATTTTCACTTTACTGCTCTAATG
CTGCTAGTCGTAGTCTTTAGCACACTAGGTGGTATGCCTTTATTAGCATAAAACAAAAAA
AACTTTAACAGGAGCTTTTACATATTACTGGGATGGGGGGTGGTTCGGGATGGGTGGGCA
GCTGCTGAACCCTTTAGGGCATTTCCTCTGTAATGTGGCGCTTTCAACTGTACTGCTGCA
GCTTTAAGTACCTTAAAGCTTCTCCTGTGAACTTCTTAGGGAAATGTTAGGTTCAGAACT
AAAGTGTTTTGGGTGGGTTTTGTTGCGGGGGGGAGGGTAACAATGGGTGGTCTTCTGATT
TTTATTTTTGAGGTTTTGTCAACTGGAGTACGTAGAGGAACTTTATTTACAGTACTTTGA
TTTGGCAGGTTTTCTTCTACTTGTGCTCTGCCTGGAGCTGTTTCCATATGATATAAAAAG
CAAGTGTAGTATTCCATTACTATGTGGCTTAGGGATTTATTTGTTTTTTAAAATCAACCA
TGTTAGCTGGGATTAGACTCCCTACAGTCCTTCAATGGAAAAGTAACATTTAAAAATCCT
TTGGGTAATTCGAATTACAGATTTAAAAGAGCTTAAGATCTGGTGTTTTGTTAATGCTTC
TGTTTATTCCAGAAGCATTAAGGTAACCCATTGCCAAGTATCATTCTTGCAAATTATTCT
TTTATATAACTGACCAGTGCTTAATAAAACAAGCAGGTACTTACAAATAATTACTGGCAG
TAGGTTATAATTGGTGGTTTAAAAATAACATTGGAATACAGGACTTGTTGCCAATTGGGT
AATTTTCATTAGTTGTTTTGTTTGTTTTGATTTGAAACCTGGAAATACAGTAAAATTTGA
CTGTTTAAAATGTTGGCCAAAAAAATCAAGATTTAATTTTTTTATTTGTACTGAAAAACT
AATCATAACTGTTAATTCTCAGCCATCTTTGAAGCTTGAAAGAAGAGTCTTTGGTATTTT
GTAAACGTTAGCAGACTTTCCTGCCAGTGTCAGAAAATCCTATTTATGAATCCTGTCGGT
ATTCCTTGGTATCTGAAAAAAATACCAAATAGTACCATACATGAGTTATTTCTAAGTTTG
AAAAATAAAAAGAAATTGCATCACACTAATTACAAAATA
caagttctggaaaaaatatttttcttcattttaaaacttttttttaactaataatagctt
tgaaagaagaggcttaatttgggggtggtaactaaaatcaaaagaaatgattgacttgag
ggtctctgtttggtaagaatacatcattagcttaaataagcagcagaaggttagttttaa