Gene ACTR1B Variant 1
DNA : 7.95 KbNT_022171
mRNA : 2052 bp NM_005735
CDS : 1131 bp NP_005726
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  79 bp
cacctgctgtcaatcgggccaggtgggagcgatgattggccgccgggcccgccctccaga
aagccccgcggggctcgcgtaggctgcaggctcggggagggagggcagcggcgccgcgtc
gggagccgccgccgtcccggtcctcccgcccgcccgcccatccggtgcctcctgcagccc
GCCTGCTGGGCAGGGCCGGCGCGGCCCGGCCATGGAGTCCTACGACATCATCGCCAACCA
GCCTGTGGTCATCGACAAC
gtgaggcccggcagccagggggagggcgggcgccccgcccccgggggcgcacgcggcggc
gcagggagagacccccgcccgcctcggcgcgtcctccgctcactgcgtggccgtcgcccc
cgccgggccgctggcttcgccccgggggcgcgcgccctcttggccttgtaaggccggcca
EXON 2  65 bp
agcagggggatacaaaattgcccccaatcttgaaccataggtgtacttgtaaatgatcct
ggcagggtccctggcttcctccttggcctgccttgacggggcagccagctctctccattg
cgggggactggcttcatctggtggtgcatgtgggcagctcaactttgtttttccttgcag
GGTTCGGGGGTGATTAAAGCTGGCTTTGCAGGAGACCAGATTCCCAAATACTGTTTCCCA
AACTA
gtaagtgtggctcaggcagcagccttagtccttttgtttaccttctgtaagaacattggc
cttctgtcacagggctctttgaagacaatttgtgccctgacctgtatggaaaacaccaaa
tttgtgaggttgacactcttgagagagcactgaaagaacaagacaagcgttctagggttc
EXON 3  76 bp
ctaggccccctctctagccccgaaccccataggccccagttccaacctgtgccccccagc
cacatcctggtgtttggaggccaggtaccctctgggcgactatggttggatttcggtttt
tctggacacaagctctgccatgctccctgcccaccttgctgacgttatccgtcctaacag
TGTCGGGCGGCCGAAGCACATGCGGGTGATGGCTGGAGCCCTGGAGGGGGACCTCTTCAT
CGGACCAAAAGCAGAG
gtaacaccgaggagcctgcctttccctgggggtggggtcctcagttgcaggaacatggca
tgtgttcttgggcctctgctggtgacctcccgggtacctcctccaggctccagctgggaa
gtgctgtgcaggggcacctccccctgagatggggcagcagttcctcttctagggagcatg
EXON 4  126 bp
aggtgagcccatgctgagttcaggacccgccacagaccctgggacacccagtgagcaggg
gtggttctggtcagggcaggtgaggttctggtcagggcaggtgagggtcagcttccagga
gggcggaaagcagccgctgagcaagggccgggtgccacacctcccttcccaccccaccag
GAGCACCGGGGGCTGCTGACCATCCGCTACCCCATGGAGCACGGCGTGGTGCGAGACTGG
AACGACATGGAACGCATCTGGCAGTACGTCTACTCCAAGGATCAGCTGCAGACCTTCTCG
GAGGAG
gtgtggcggctgcccctcctgcatgctctgcattctcctggccatgcccctctcctctgc
gtccctcctcgccgggctcccacatttcccttctacatttctagagggcctgctgccttt
ccgtgtgtgtctgggtgcgcatacgtacccagtggctgctaggcagaatcttccaaagag
EXON 5  125 bp
tcttccaaagagagccggatctccggaagagtaactgccagcagataaagggatggggcc
ctcaggaggggtaggaggctgagctgcctgtgcgccagcgggtgtggttctctggaaaga
gccttttagggccttgcaagttgcctcctctgatgcctacaactgtcccgtccctcgcag
CATCCTGTGCTCCTCACGGAGGCCCCGCTCAACCCGAGTAAGAACCGGGAGAAGGCGGCA
GAGGTGTTCTTTGAGACCTTCAACGTGCCGGCCCTGTTCATCTCCATGCAGGCTGTGCTC
AGTCT
gtgagtgctccctaagcctggcctccctgagtcctgtcctccctgtgccgtcctgcttgc
catgaccagggtctgacttccctggaaaaacagccccttgatgactgttcctctagggag
tccctcgtgtcctctcttcagactagataatgcagatgtgccagggttcctcccctgggt
EXON 6  217 bp
cttgccatgaccagggtctgacttccctggaaaaacagccccttgatgactgttcctcta
gggagtccctcgtgtcctctcttcagactagataatgcagatgtgccagggttcctcccc
tgggtgaggaggtccccgtgcctcagtggctgaggtgaggggatgctgacctggtgacag
GTACGCAACAGGACGCACGACAGGAGTGGTTCTAGACTCAGGGGACGGGGTCACTCATGC
TGTGCCCATCTATGAGGGCTTTGCCATGCCTCACTCCATCATGCGGGTGGACATTGCCGG
CCGCGACGTCTCCCGCTACCTCCGACTCCTGCTGCGCAAGGAAGGGGTTGACTTCCATAC
CTCGGCTGAGTTTGAGGTTGTCCGGACAATCAAAGAG
gtgacaaggggcgagagggtgtggacacgacctggggtgaggaaagggtggcaccaaggc
acaggtgtcccaggtgcagccttctgagggctgtgtccctgtccccgcagcgagcgtgct
acctgtccatcaacccacagaaggatgaggctctggagacggagaaggtgcagtacacgt
EXON 7  93 bp
cctgctgcgcaaggaaggggttgacttccatacctcggctgagtttgaggttgtccggac
aatcaaagaggtgacaaggggcgagagggtgtggacacgacctggggtgaggaaagggtg
gcaccaaggcacaggtgtcccaggtgcagccttctgagggctgtgtccctgtccccgcag
CGAGCGTGCTACCTGTCCATCAACCCACAGAAGGATGAGGCTCTGGAGACGGAGAAGGTG
CAGTACACGTTGCCAGACGGCAGCACGCTTGAT
gtaagtggccgggcctggcactggagtggcagccgatgcccagcctgggggaaggggtag
cccgcttctccaggaagcctgtctgcctcaatcttgtacactaaaggtggggcctgcacg
attccgggcccccgagctgctgttccagccggaccttgtcggggatgagagtgaggggct
EXON 8  175 bp
tcaacccacagaaggatgaggctctggagacggagaaggtgcagtacacgttgccagacg
gcagcacgcttgatgtaagtggccgggcctggcactggagtggcagccgatgcccagcct
gggggaaggggtagcccgcttctccaggaagcctgtctgcctcaatcttgtacactaaag
GTGGGGCCTGCACGATTCCGGGCCCCCGAGCTGCTGTTCCAGCCGGACCTTGTCGGGGAT
GAGAGTGAGGGGCTCCATGAGGTGGTGGCCTTCGCCATACACAAGTCCGACATGGACCTG
CGCCGGACGCTGTTCGCCAACATCGTGCTCTCAGGTGGCTCAACGCTTTTCAAAG
gtactgtggcttgagagttggtggtggtgagacgaggcccagggcagctggaccctcaga
gagtatacccctacccagagccatattctgttggctttttggtggtgctcaatgaacatt
ttttttaacagaccaaaatttaaaattaaattttgtttactctgtgaatagaggagaagt
EXON 9  62 bp
gaggacgcagggcccgcaggcagccatggggctggatcatttctcagccttgcccttcat
cctgggaagagctgctgatagaggaccagcagtagctgggggccctgaaggctgggtgcg
ggagctagcagcgaggaggccgggtgcagaccccaggctcagccagctttgtgttcacag
GCTTCGGAGACCGATTACTCAGTGAAGTGAAGAAGCTTGCCCCAAAGGATATCAAAATCA
AG
gtgaggttacagaaactccccctggggcactagggcgctggcagccttggcatggggagg
aaggttgaatgctgcccccagacccgctcaccagctcacgtccacctagtcctgttcttc
ccaaggctgctgctgccactccccagcttatgcctttgctgtcaggcttcaggacctggg
EXON 10  41 bp
ccccagacccgctcaccagctcacgtccacctagtcctgttcttcccaaggctgctgctg
ccactccccagcttatgcctttgctgtcaggcttcaggacctggggaaggtgaccccaag
gctgggaggatggcttctgggtggggatccacagttaacgtggccacttcctccttctag
ATCTCAGCCCCGCAGGAACGGCTGTACTCCACATGGATTGG
gtgaggcggggctcaagggagggctctgggaggagaccactttaccctggatgctcctcc
cattgttggcctaggccacgtggaggtgggtggatttccctcccaaattagggaaatgca
actctgagcacccaggaaggtggttggctccctgacaggtccacagcaatactatccctc
EXON 11  993 bp
ctcaagggagggctctgggaggagaccactttaccctggatgctcctcccattgttggcc
taggccacgtggaggtgggtggatttccctcccaaattagggaaatgcaactctgagcac
ccaggaaggtggttggctccctgacaggtccacagcaatactatccctccatccccacag
CGGCTCCATCCTGGCCTCGCTGGACACTTTTAAGAAGATGTGGGTGTCCAAAAAGGAGTA
TGAAGAGGATGGCTCCCGTGCTATTCATCGCAAAACTTTCTAGTGCCCAAGGAGGGCGGG
GCATGTTGGGAGAGGGGGAGGGAGGGGAGACAGAGCCTTTAACCCTTTTTGGTCTTGGCT
CGTATACTAGGCTTAGGGTCCCCTGCATGCCCTGAACCCCTGGGTGGGTGGCACAGCAGT
GCCCCCCTGCAGCCTTCCCCTCTACACAGGACATGCACACACAAGTAACATTGAGCTGCA
TGGACAGGAGCCTTGAGCTGGCGTGTGGGAATTGAGCGCCATGTCAGGCTGTTGTGGGTA
TCCCCCTGGCAGGGCCAGCTAGGCCTGTGGTTCCCTGCTCCGACTCTCAGGGCTGCCTCC
CTGAGCTCCAGGGCCAGAATGCCTGGATGCCTGGGTAGCCAGTTTGGGGAGTGGGCTGCA
AGGGGCAGCCAGCAGCTCCCACTGGTGTGTCACTGCATCCATTGCCACCTCCTGTTCGTG
ACCTGACAGGGTGACACAGCCCCTTTCACACTCTGTCCTCCTATCTTCCTGGGTAGATGC
CCTGGTGTAGGGCTGAGTACTGAATGGTCTTCCATCCCCAGCAAGGGGGTGCAGCCCAGG
GTCAGGCCCTTCAGAGCCAGGGCAGAGGATGCACGGTGGCTAGAGCCGCTGCACTATCCT
TTTCAGAGCACTTCATCCACTTGCTCCTCCCTCTACCCTCGGCACCCTGGGTGGGAAAGG
GTTGATGCTCATCATTTATTGAGGGGAAGCCACTTAATAAGGAGTCAGACCTAAAAGGGG
GTGGGGGACATTTTCTTACCTCACCCAAGAAAGAGGTCGTCACTTTTGCTGTGGCCAGGG
CCCCACCTCCCTCTCTCAGATATGTACAATAATTTAACACGGTTGCCTGAAAAAAACTTT
TGTAAATCATTATAGTAATAATTATGGACAAGG
cccagtgtgtggctctgttttcttgtggctctctgtgctatcgtttgttcttccatccct
ggggactttcagagaaaggaccagagagaatgcagcaaggcactggctctagcttagcgg
catgaaggtttcagtggttggcccgccaacgtggcacaaaaagcctcaggaggctgggct