Gene ABCG8 Variant 1
DNA : 38.86 KbNT_022184
mRNA : 2022 bp NM_022437
CDS : 2022 bp NP_071882
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  63 bp
agtgggcagaacacacacgtttgtaggtgggcttgccagcaaggaatgctgggagagacg
ggcccagggcaggaggccgaggtgtccctgctccaggaaacagagtgaagacactggccc
tggcaggcagcagctgggtctaagagagctgcagcccagggtcacagacctgtgggcccc
ATGGCCGGGAAGGCGGCAGAGGAGAGAGGGCTGCCGAAAGGGGCCACTCCCCAGGATACC
TCG
gtgagtgagcaatgggaagtcggcccaggcctggtgggcgggtaggagaaatcaaacctt
tctctcttccctcaggagccttctgtcctagcaccacccggacatcaagcagtgtgagga
catggccgcaggactgtttcctgcatgtcaaagggcggaggggaacagattcagggtccc
EXON 2  102 bp
tcagcactcctattttcccaaagccctgaggttccacctgtgcaatcccatctgttgcca
atttgagatttaaccacgtcggctctaagaagttgctctcacctgttggtttccttcttg
tcttctcctatgttctcagcagcttctaaaggagcccctcatctctcctgtctcccacag
GGCCTCCAGGATAGATTGTTCTCCTCTGAAAGTGACAACAGCCTGTACTTCACCTACAGT
GGCCAGCCCAACACCCTGGAGGTCAGAGACCTCAACTACCAG
gtagaggcacgcctgggttcaaggggagaggagcaggcagggacagccaggaaattcccc
gggtggaaataaaagggtgggcccaacttgcaggccctctgcccgcaaggacagagtcca
gtccacattgatgcctcacgtgtcaggtgcaataggtgtcatcaatggcatatatcagag
EXON 3  157 bp
ttctcagcatgggtcctgcttccgtgtttggtagaacctgggttggggcctattgtgtgt
aggtgaggacatatcctctgtggagaggggccacctggggaacgaagatgctgaacagaa
gttgctgaagccctctgaaccattcagctctctaaggaaccttctgatatctccccacag
GTGGACCTGGCCTCTCAGGTCCCTTGGTTTGAGCAGCTGGCTCAGTTCAAGATGCCCTGG
ACATCTCCCAGCTGCCAGAATTCTTGTGAGCTGGGCATCCAGAACCTAAGCTTCAAAGTG
AGAAGTGGGCAGATGCTGGCCATCATAGGGAGCTCAG
gtaccggaaaggcaaatcgctgggcaatggtttctctcctgggatacagaatggtccttt
ggacaaatggatgcttcttatggagctctttgctgactagtagaataatacagcagaatg
gctgagaacacaggttctgggtcagacagacctgggctcaaatcctggctcctccatttg
EXON 4  239 bp
gagctccatgtcctgggcccaccccatctaggtccagggactatgccacctctctagggg
ctggtcacatctgcacggacagagtagtccggggtcctggagagtgtatggggagcagtg
gctgacagcctggcccccacagaagctccgctctcagggatatccctggtggctttgcag
GTTGTGGGAGAGCCTCCTTGCTAGATGTGATCACTGGCCGAGGTCACGGCGGCAAGATCA
AGTCAGGCCAGATCTGGATCAATGGGCAGCCCAGCTCGCCTCAGCTGGTGAGGAAGTGTG
TGGCCCACGTGCGCCAGCACAACCAGCTGCTCCCCAACTTGACTGTGCGAGAGACCTTGG
CCTTCATTGCCCAGATGCGGCTGCCCAGAACCTTCTCCCAGGCCCAGCGTGACAAAAGG
gtaactaactggccccagtggtgacccccaggtccaagaagctacagtgtccatgccccg
ctcctcccctgctgccttgcctcaggacccagccgcaggtcgagtttgaacaactcagct
tgccttccgccagccctgggctgcagcccaccctccaccctcctttcaaaccccacagcc
EXON 5  133 bp
cgggacctgtggaaagaatcaggggaaccaatgttgcagcttggaactcaagtgctggag
ctgtctcccttcactttcaaacccagccggaggagcgggcgcctttatccttggggtcac
aatgtgtccagccctgaaggaggcccctgaggtggcctcaaagctccttctggcccacag
GTGGAGGACGTGATCGCGGAGCTGCGGCTTAGGCAGTGCGCTGACACCCGCGTGGGCAAC
ATGTACGTGCGGGGGTTGTCGGGGGGTGAGCGCAGGAGAGTCAGCATTGGGGTGCAGCTC
CTGTGGAACCCAG
gtgagggcctggggggcagatgggggcagagggacctgtgcggtcccctcaggcttggct
tggtctggccagagccccaccgactcaccaggctcctctctgtgttggaaaggaatcctt
attctcgacgaacccacctctgggctcgacagcttcacagcccacaacctggtgaagacc
EXON 6  270 bp
cgtgcgggggttgtcggggggtgagcgcaggagagtcagcattggggtgcagctcctgtg
gaacccaggtgagggcctggggggcagatgggggcagagggacctgtgcggtcccctcag
gcttggcttggtctggccagagccccaccgactcaccaggctcctctctgtgttggaaag
GAATCCTTATTCTCGACGAACCCACCTCTGGGCTCGACAGCTTCACAGCCCACAACCTGG
TGAAGACCTTGTCCAGGCTGGCCAAAGGCAACCGGCTGGTGCTCATCTCCCTCCACCAGC
CTCGCTCTGACATCTTCAGGCTGTTTGATCTGGTCCTCCTGATGACGTCTGGCACCCCCA
TCTACTTAGGGGCGGCCCAGCACATGGTCCAGTATTTCACAGCCATCGGCTACCCCTGTC
CTCGCTACAGCAATCCTGCTGACTTCTATG
gtgagtccccaaggccagcagccagggccctggcacacagggcctccccgatgcttaaac
cctgcccaagcttgctggaaagattcaggggagaaactcccagaggtttcaggagaggag
gagcaatgatggggaagaacatggggtggtttgccaggtatcaaatgctagaaatgaggg
EXON 7  163 bp
ccttggggtccctctgcctctctctgctctgccccttgcttcatggctgagggtggggag
aatgtcccagagccccacgaggggtgatcagcattgtgagctgggcgtgcaccaagctct
tcacctgtgagcaggtgccagggaacaggccacctgtgactccacatcccctgcttgcag
TGGACCTGACCAGCATTGACAGGCGCAGCAGAGAGCAGGAATTGGCCACCAGGGAGAAGG
CTCAGTCACTCGCAGCCCTGTTTCTAGAAAAAGTGCGTGACTTAGATGACTTTCTATGGA
AAGCAGAGACGAAGGATCTTGACGAGGACACCTGTGTGGAAAG
gtaaggtggcaggcgactctgagaggagagctccctgcagaaggtggctgcccccatgac
ctggccacatcttctgcctcccagcagcgtgaccccactagacaccaactgcctcccgag
tcctacgaagatgcctggggcggtgcagcagtttacgacgctgatccggtaattatctgt
EXON 8  84 bp
actcgcagccctgtttctagaaaaagtgcgtgacttagatgactttctatggaaagcaga
gacgaaggatcttgacgaggacacctgtgtggaaaggtaaggtggcaggcgactctgaga
ggagagctccctgcagaaggtggctgcccccatgacctggccacatcttctgcctcccag
CAGCGTGACCCCACTAGACACCAACTGCCTCCCGAGTCCTACGAAGATGCCTGGGGCGGT
GCAGCAGTTTACGACGCTGATCCG
gtaattatctgtcattttattactgaacccgcccccctgcccaagtctttgtatatcaca
ttaagccctttctattaaagtgaatttaaaggagaaagtgagaggtagagtcatttgaaa
aaaacagcatccagcagggcgttggtggcttatgcctgtaatcccagcactctgggaggc
EXON 9  200 bp
tgtgggacagatgctgtcatcagttttctgatttaatcctcagagccactctatgaggca
ggtattaccatccccattttgcataggagaaaaatgaggcttatggagactgtgacattc
ccagggtcacggggctggtgtatgctgttgcctcagcatctcttccttttggtttttaag
TCGTCAGATTTCCAACGACTTCCGAGACCTGCCCACCCTCCTCATCCATGGGGCGGAGGC
CTGTCTGATGTCAATGACCATCGGCTTCCTCTATTTTGGCCATGGGAGCATCCAGCTCTC
CTTCATGGATACAGCCGCCCTCTTGTTCATGATCGGTGCTCTCATCCCTTTCAACGTCAT
TCTGGATGTCATCTCCAAAT
gtgagtgtggcccactggcatgggcaggcaggacctcagccacctccaagctgtgttcct
ctgagctcctggggagcgggtttgatttcattgtgattgtgatatataagacaataatgt
ttttaaagtttgcatgttaatattagcatacaaatgaaagtaaattaccgagtcttagct
EXON 10  77 bp
ctgaagagcctcatcaaacatctaaattaggatggctttactgtgcctatttaaaaaaaa
aaattagagacttgggcaatatgataactactttgaattgtattaagagagtctccaaaa
cagaagcactgtagatttattctacttcttcattctcttttcctttcccttactttttag
GTTACTCAGAGAGGGCAATGCTTTACTATGAACTGGAAGACGGGCTGTACACCACTGGTC
CATATTTCTTTGCCAAG
gtgactgggcagggttgagagcaagtgccccccacccaccagggtgggggtaagtgtgga
gaaaacgttgctacaaggaaggcttttctgaaccatggggccgtgggtcatgtgaagtca
ccgatgccaccagatgccacattttctaggggagtttcagagacttgaacttttatttta
EXON 11  268 bp
tctgcaagggggaggccagcactgagctcatgctcctgggtcccagcacaccctcctgcc
acagcctcatcatcaccaggagggaaggttgctatctgggggcactgctacttttaaacg
tttataataatggcagtgaaggtgctggcttcatatccttgcaagggctgttctttgcag
ATCCTCGGGGAGCTTCCGGAGCACTGTGCCTACATCATCATCTACGGGATGCCCACCTAC
TGGCTGGCCAACCTGAGGCCAGGCCTCCAGCCCTTCCTGCTGCACTTCCTGCTGGTGTGG
CTGGTGGTCTTCTGTTGCAGGATTATGGCCCTGGCCGCCGCGGCCCTGCTCCCCACCTTC
CACATGGCCTCCTTCTTCAGCAATGCCCTCTACAACTCCTTCTACCTCGCCGGGGGCTTC
ATGATAAACTTGAGCAGCCTGTGGACAG
gtaaggcctgcccccggggcctgggccagctttgttaggactcatgtgactggatgaagc
ctgctttcatctggagatggacacttatcacttagatccaactcgaggctggcccttctg
gaagcagaggcctttgcccactgccctggaggccaaaggaatgattccattagagattcc
EXON 12  128 bp
catgggaatatggggagactgaatatatgggagactgtgggaatatggggagatcatgca
aatatgggcagaccatgggaatatggggagactctgtgaatatgggggagaccatgcgaa
tatggggaaaccatgagaatatgagggacacctgtgagtaacgcggctgtctgtctccag
TGCCCGCGTGGATTTCCAAAGTGTCCTTCCTGCGGTGGTGTTTTGAAGGGCTGATGAAGA
TTCAGTTCAGCAGAAGAACTTATAAAATGCCTCTCGGGAACCTCACCATCGCGGTCTCAG
GAGATAAA
gtaagcggggaaggcctcgggttctaaattattggacgtccggctttccatcctcctcat
gagcccactgcatgtctgtgtctccagatcctcagtgtcatggagctggactcgtaccct
ctctacgccatctacctcatcgtcattggcctcagcggtggcttcatggtcctgtactac
EXON 13  138 bp
tggtgttttgaagggctgatgaagattcagttcagcagaagaacttataaaatgcctctc
gggaacctcaccatcgcggtctcaggagataaagtaagcggggaaggcctcgggttctaa
attattggacgtccggctttccatcctcctcatgagcccactgcatgtctgtgtctccag
ATCCTCAGTGTCATGGAGCTGGACTCGTACCCTCTCTACGCCATCTACCTCATCGTCATT
GGCCTCAGCGGTGGCTTCATGGTCCTGTACTACGTGTCCTTAAGGTTCATCAAACAGAAA
CCAAGTCAAGACTGGTGA
ttcacgccagacgtctgcccgctggtgggggacctgagcagacccttcaactgcactccc
tcctcaggagccccttcctggggacagtgaggacaatgaccctacagatgctcagctaca
tccggcccagggtgctgcagtggcacagaccagccacaggatggcagtagaataaagaca