Gene ABCA12 Variant 1
DNA : 206.88 KbNT_005403
mRNA : 9097 bp NM_173076
CDS : 0 bp
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  289 bp
tcatggagagtaggaggtgtgggttcagctgctgcttttttttttttttcagtgaggcat
tatctgaatgatgctcattctctcttgagtctggacttcgtgcaacaagcagcaactgga
tattattttaaaataagcataagccacccaaagatactgatctgggtccttcttttggaa
GAAGAGTTGATTGAGAAGTGCCTCTTGGTTAAGGATTAACCACAGGGAAAAATCCAGCAG
AAACAGAAGAACTGTGGGTTTCTTACCCCAGCCCTCAAGGAAGCTATGCCGTGAAAGGGG
TACTGATACACTGACATACAGCAAGTTGGACGGGGCATCAGTTCTTCATTTGTGGAGTGG
AGAAAAGAAGAGGAAATCTCTCATTTGGGGCATTTGAAGGATGGCTTCCCTGTTTCATCA
GCTTCAGATCCTGGTCTGGAAAAATTGGCTAGGTGTAAAAAGGCAGCCG
gtgagttaaaaaaaagtgtgggagtatgggtcatggggcaatacgccaggtaatcctaaa
atgtgatcttaatgagaagtgaaaacagaagagtttaaaggcattttccaaagcaggaag
taagatatttagaattcatccccctatctgtcttatagctaatggagcgagtcttaacat
EXON 2  94 bp
ttacaggtcttttacatattaaaaaaatctctcattcactttttattaataatatctaca
gttggtcaaatattcagcttgtgttgaaatattatagtatgacatactttttgtagtcag
gttttaaaaatctttggttcaacaataaaactaacaattttttctaccattattttgcag
CTTTGGACACTTGTCTTGATCTTATGGCCAGTCATTATTTTCATAATTTTGGCTATTACT
CGGACCAAATTTCCTCCAACTGCAAAACCAACTT
gtaagtaaatgacatttgtttatttccttaatttttggattctagttaaaatttattttg
gtaccactttagtgtttcatttcaaaaatttttttttgtatagtgttttcacttggaagg
attaatatgaacaatttgtgtgttttttaccctagattttcaagttagtcagaaagttga
EXON 3  154 bp
aacaccctccaagactgctcctactcagtggtgagtgttagttgcagagttggggctcag
ttgggggacccggagagtggtaatccaggaggttaacttcacaaagtggagttactgcat
ttatgttctttcccagacaaatgtgccatactgatgtaatgactgtttttttaattttag
GTTACCTCGCACCTCGAAACCTTCCTAGTACTGGATTCTTTCCATTCCTGCAGACCCTAC
TCTGTGACACAGACTCTAAATGCAAAGACACACCCTATGGCCCACAAGATCTGCTTCGTA
GGAAAGGAATTGATGATGCACTATTTAAAGACAG
gtgggggcacttctcaagtgtgttcaattgttctgagagatcaaatcttgtttccttctg
agatagccaggaagccatgcaagcttagatatgcaattttgttttctctgtctataaatg
tgatgatctaaatatgaaataacaaagtaggtataaactggaataactgtttatgtgaga
EXON 4  92 bp
ttgtaggagaccttatatattcattggtgtgtggttaggtgaattcttccattaaaatcc
tggaaactatattaaatatttgaaagtcctcagacagccctggaatctgccacataatac
attgctgtaactaaaattaatgtgggagaagttacagagttcttgctttttcttctctag
TGAGATTCTGAGAAAGTCATCCAACCTGGATAAGGACAGCAGTTTATCATTCCAGAGCAC
CCAAGTTCCAGAAAGAAGGCATGCATCACTAG
gtaagctattttcttctgtagagttcagaacaagccttatggaacagtaaaggtctaatc
tttgaaaggtttatactttaaacttttcaaacaaagaaggaatgcttagaatagccctgt
gagatctaaacgttcctcatggttgcctgagtatggcggtgcaattacgcaaaggtgttg
EXON 5  98 bp
agaaaaactcatggaatttgccacttttccagtataaaacttccatggaagaggcatgtt
tgagcacatccttgctgtagggtatatgaggtcacaagtgatgtttatggattctcatgt
ggtcctgtgcatttgtgtgtgtgtgtgtggaatgctaatctgttccttctttgattacag
CCACAGTATTTCCCAGTCCAAGTTCTGATTTGGAAATCCCCGGAACATATACTTTCAATG
GCAGTCAAGTGCTCGCACGAATTCTTGGCTTGGAAAAG
gtaacttgattcaattttgtaatgggtagagtgattcaacataggccttttaggttaata
gaaggatctctcaaatagcaagatgtttggagcacctttcctatttagggtaatatctca
ggcaacttcttttcttaggaacccttcaataaacagcttaattttaagacattctgaatt
EXON 6  186 bp
attcgctctacaagtttcatgggtaaactctatctactttattgttattttaatagctgc
tataatggaggacctcaaaatggctattttgaagacagcttagattccttgaagaataga
atatttgaacatctacatttattaacactcttattttactcttttcacacatgcttttag
CTGTTAAAGCAAAATTCAACTTCAGAAGATATACGAAGAGAACTATGTGACAGCTATTCA
GGATACATTGTGGATGATGCCTTCTCTTGGACCTTTCTAGGAAGAAATGTTTTTAACAAA
TTTTGCCTTTCTAACATGACCCTTTTAGAGTCTTCTCTCCAAGAACTAAACAAACAGTTC
TCCCAG
gtgagtgtagatctttgatccacaaagtgactcaacatgaattaaagggtaaatctatag
cccgtgtagactgggaaatgctgactgggatatttgtttaccttaggcatgttttcctca
catagacatttgcacacaaagtttaatcttaagtagtattacttatttaatgtgaaaggt
EXON 7  179 bp
ttaagaacattagaagtagttgctggttttccaaataaaagattggcttcaaactgagtg
aaggtctaaaagaattgcttatgtgaaaatctagatttttgatgcttttaaaaacagcaa
accatgtgattacaaatgttaaagtctcattttgctctgtttgtggttttatattttaag
CTATCCAGTGACCCCAACAATCAGAAGATAGTGTTTCAGGAAATAGTCAGAATGCTGTCT
TTCTTCTCACAAGTGCAAGAGCAGAAAGCTGTGTGGCAGCTTCTGTCTAGTTTTCCAAAT
GTGTTTCAGAATGACACATCACTAAGCAATCTATTTGATGTTCTTCGAAAGGCAAACAG
gtaagaaaatgtaagaattaaatgtaatattagtgttcacaaagaagtgtttaaaaaaat
gttacctgtgatgattactgttatctgggttatttaaacacagagcaaataatccttcag
cctcttattgcagattttagcagtgaaggtgagtgtattagttaagcaaagaagaaacat
EXON 8  113 bp
attttgttgagattttgtgcatgaacagacaaacaagtaattaaattacaaaaagtagca
tcttgtcttttatattataagaataatttatactgtagccattttctccttgaataatct
tttgtttctgtctgcaaaccttgaaacagaatctggtttaattgctttttgactccttag
TGTGCTGCTGGTTGTGCAGAAGGTTTATCCACGTTTTGCAACTAACGAAGGTTTCAGAAC
CCTCCAGAAGTCTGTTAAACATCTGCTGTACACTCTGGACTCCCCAGCTCAAG
gtattatatttccatcttactgtgttaaattcagtgtcacaaagcccattggaaatataa
agcagagtgcaatgaaagtaatcatgtagagatgatattattcttaggtggggacatatg
ctatgaataaatctggatctcgagttaatcaaagtgtggagaaagggagaaatggccaag
EXON 9  76 bp
aatatcacaaatatttccaacaaaagagcatagatgtcttttatacaattcttttgagaa
tgattctgcagatttctgcattttctcctcattaatttgacctgggatggttttcactga
ggaaaaaaatctttaagcaaacatgttaaatgtttacctatataaaaattattacttcag
GTGACTCCGATAATATAACGCATGTGTGGAATGAGGATGATGGACAGACCTTATCTCCAA
GCAGTCTGGCTGCACA
gtaagtctttgtttatttctaaataggtagataacttggctgaataaacaatcaaaacaa
tttctaaacataattcgcttatcagtgtatataagcatggaatagaaaaatcaactattg
actgagcagaggaaagggcatagtccaagtgtagtaaagttgaaacttattttttgatat
EXON 10  119 bp
ctcgtctcggcctcccgaagtgctaggattacaggcgtgagccaccgcgcccggccaact
gcatagtatttcaatgtccaagtcaaccaatgccaaacaagggaccaaaatgatctcaac
aaaacggctttgctttacttttatatgtcttaatttctatattcttttctaattctgcag
GCTCCTAATTCTGGAAAACTTTGAAGATGCCCTCTTAAATATATCAGCAAATAGTCCTTA
TATTCCTTACTTGGCATGTGTGAGAAATGTGACTGACAGTTTGGCCAGAGGTTCACCAG
gtaatactgttcttaacagtcaaaatgctgctcatggtttctacctctgttctaaagtag
tgagtttttgaggcatttgcttacacaggaaagaaaatttgtaaaatcttagtttccata
tgcatcagtttcagtctggtgatttgatatacaaagggaatgtcttgtcataatatcata
EXON 11  107 bp
actctgttgtccccatggttcaaataaaggttaaattttcattcatcttatgtttgtatt
gaggtaggctattatcttaggaaaaatttagtaataagtcaggatagaggtgtctttcaa
actggtttcctaaatgaccttgcaattcacataaagtaactcttctcccttcctttacag
AAAATCTAAGACTCCTGCAGTCCACAATACGATTTAAAAAATCTTTTCTTCGCAATGGTT
CCTATGAAGATTACTTTCCTCCAGTTCCTGAAGTCCTAAAATCAAAA
gtaagccatgaaagtaaaaaaaaaacaaaaaacaaaaaaaaaaacaaaaagacaaaacaa
acaaaaaaaaaaccttaacacttctcataatatttggcaagatacacttttaagttttaa
atctgatctttgtaaataatgatgctattttaactctagatttataatggccctacttac
EXON 12  257 bp
taaactcaaatgacagacggtagtacttcataataaaactaacgccaaatgccaactaac
cacatacataggcagaatgtttttcttaaaggaaatcaattgtggttgcttattatcaac
tactatatatgtagaaaaatgtaactaatctatttcccactcttttccctttttggaaag
CTGTCTCAACTTCGAAACTTGACCGAACTTCTTTGTGAATCTGAAACTTTCAGTTTGATA
GAGAAGTCATGCCAGCTCTCTGATATGAGCTTTGGGAGCCTGTGTGAAGAAAGTGAGTTT
GATCTGCAACTCCTCGAAGCGGCAGAGCTGGGCACCGAAATAGCAGCCAGCTTACTGTAC
CATGACAATGTCATATCTAAAAAAGTGAGAGATTTGCTGACTGGAGATCCAAGCAAAATT
AATTTAAATATGGATCA
gtaagtttttccattgtcttcttccttggtgaaatctctttcaaaatattgaaatactta
gttgaatttcttcttttctgttttgttccaggtttctagaacaggcactgcaaatgaatt
acttggaaaatatcactcagttaataccgatcatagaagccatgctgcatgtcaataaca
EXON 13  113 bp
agcttactgtaccatgacaatgtcatatctaaaaaagtgagagatttgctgactggagat
ccaagcaaaattaatttaaatatggatcagtaagtttttccattgtcttcttccttggtg
aaatctctttcaaaatattgaaatacttagttgaatttcttcttttctgttttgttccag
GTTTCTAGAACAGGCACTGCAAATGAATTACTTGGAAAATATCACTCAGTTAATACCGAT
CATAGAAGCCATGCTGCATGTCAATAACAGTGCAGATGCTTCTGAAAAGCCAG
gtgtttccccatccacattttaaatcttgtcttattagaatgcatgtgattctcacgctg
cagtttaagaaagcttttttgaagttcccaaccaaactcgctttgctatctgcccttaca
catgagaaacctgaagcattcaaatatggttacttgtctaaagtaaacacacagaaagct
EXON 14  125 bp
acaaatctaaatcagatagaaatagatcctaaatatgcaacgtttgccaaaactgggaga
catctgcccctgagaaggcacgtatgtcttagtctagaaggtttctctatgttagtcata
ctaaaaagagtgacctgacaaaccaacatgggttttctttttacatttttcttcttgcag
GTCAGTTACTAGAAATGTTTAAAAATGTTGAAGAGCTGAAAGAAGATTTAAGGAGAACAA
CAGGAATGTCCAACAGGACTATTGACAAGTTGCTGGCCATTCCCATCCCTGATAATAGAG
CTGAG
gtggggtgtcatgtgtttgtacttacatgcagttcttagaaatttaaatagcatttagca
tttgttgagcgcttaccagttaaacactgagaagttgcatgctaatctggtgaattttct
atgcaagtgataaacctggaggcctcattaaagatagaagaaaaattctgaagcaagaat
EXON 15  174 bp
tgaactattaattctctattgtcttattaatagtaattagtgctttagatgaaaagttgt
ttgattcttgaggaccttttgttttagtttaaaatttagagtatacagaaaacctcacaa
aatgaacagttgactctcgaatgattcacagttgaaatatttttcttcctccatttgcag
ATTATTTCTCAGGTGTTCTGGCTGCATTCCTGTGATACTAATATCACCACTCCCAAACTA
GAAGATGCAATGAAAGAATTCTGCAACCTGTCTCTTTCAGAGAGATCCCGGCAGTCTTAC
CTCATCGGACTCACCCTTCTGCACTACTTAAACATTTACAACTTCACATACAAG
gcaagttgctgttggttaaatatgtttatattcatggtttatataaaactatttaattat
acatttatgttctctgatactatgagggatgagatccatttattcggcttttggaattat
tgcattatgttaaagctaaatgcaaccttagagatcatttattgcaattttgcacgtttt
EXON 16  165 bp
tctcttaggtaaacgcccaggaatggaattgtcaggttgagtgttaaatttacatttaac
tatttaataaacttcaaaaatgttttccaaagtggctgtacctttctacaaccttaccaa
caatgcatgaggattcaatttttccacataaagcatttatttttattctgtttctgttag
GTGTTTTTCCCGAGGAAAGATCAAAAGCCAGTAGAAAAGATGATGGAGCTCTTCATAAGA
CTAAAAGAGATTCTCAATCAGATGGCTTCTGGCACACATCCGCTGCTAGACAAAATGAGA
TCCCTGAAGCAAATGCATCTGCCCAGAAGTGTTCCATTAACACAG
gtagcaaagtcacccagtaatgttcttgttgaaaaatgccttctgtcatattgagtagtt
ataatacattcagcttcaatcgtagtacattgaaaaaaaaaaaaacaacacctacaagaa
aactcttctacctagcaacactttttgccactttaattagtgaagtttattgttcttcat
EXON 17  211 bp
tttttgccactttaattagtgaagtttattgttcttcatttacatttggaataaacatat
aaaaggaattatggaaactgtaaggatactctaagtattatcaggttctctttctctgtt
gttttcagtagcttctaaagctcatatagtgtcaataaattgtggatttttgtctcacag
GCAATGTACAGAAGCAACCGAATGAACACACCACAAGGATCATTTAGCACCATCTCCCAA
GCATTATGTTCTCAAGGAATTACCACTGAATATTTAACTGCCATGCTGCCCTCTTCCCAG
AGGCCAAAAGGCAACCACACCAAGGATTTTTTGACTTATAAATTAACTAAAGAGCAAATT
GCTTCAAAATATGGAATTCCCATAAATTCCA
gtgagtatactttaaaataagcatgacagttgcccttaatgacaataagaatactgtcta
ttctgtcttagttttttatgataaatgaagtattaattttccccaagaataaaaatagaa
aataattatacagcacttaccacatgtcaagaatgttatatacattaactcatcttagta
EXON 18  140 bp
aaaagattggttactgtgctttcttactttgacaccagatgcctcacatctgttaataat
ataggaagtactagagcatgtatttttgggtgtgataagaataatctctgtcaatttgcc
atgtggaaatggatttgaagtacatctattaaatggttttatttcactttttccttccag
CACCATTTTGCTTCTCCCTTTATAAAGACATCATTAACATGCCCGCTGGACCTGTGATTT
GGGCTTTCTTGAAACCTATGTTGTTGGGAAGAATTTTGTATGCACCATATAACCCAGTCA
CAAAGGCAATAATGGAAAAG
gtttgaccattataactcagtttctattttgactattaagatgttttttaaagtagtcaa
cttccaaatttactttagctgactgatttctttctatcttacctactattattattatcc
ttggctttctgaaactattagtaaaattctcaacttctgccctggatatgtgcaagcagt
EXON 19  120 bp
ctatgaaagctgtcatttgaaacttttgaccatgtgggaaatttctgacaattgtttgta
ctaacttcatgttttagaactgtcttttgaagttacgtaacaaaacaatcttaagatacc
ttgttaaaatatagacaaaatactaatggatcacacttcttttgtttctttgtcattaag
TCCAATGTAACTCTGAGACAGCTGGCGGAATTAAGAGAAAAATCTCAAGAGTGGATGGAT
AAGTCGCCACTTTTCATGAATTCCTTCCATCTGTTAAACCAGGCAATTCCAATGCTCCAG

gtatgagatgcttctgtcattcaacttagtaggaatttgaattctttgagattttaattg
ccttcaatatgtgaacgggaagggggtaactttccgtattcaacagattaaattgcctct
cttccagagagaaggtctgagacagggtaactgatctatcactcatattcataattggct
EXON 20  91 bp
tcattaccaacccccaatcttctcttttcttctcaaggatttctctgtgagcctttgcaa
gacagtgcattgataatgcccagttgtggttactgcacttcactgtggtggttattagag
agacaatgtcaaacatgatttttcttgtattgaaactgatttttaattattatttgttag
AATACTCTAAGGAACCCTTTTGTGCAAGTTTTTGTAAAGTTCTCCGTGGGACTCGATGCT
GTTGAACTATTGAAACAGATAGATGAACTCG
gtgagtccaaattcacaaagcttttattcatgagtcatgtcggacatataaacaacattg
ttccatatgattacattttccccccttttctcctgtacttagtttgtagctagctactca
aagaaaaatgagaccctggatatatcccccctatcttcttcccagttagttgtacaatta
EXON 21  180 bp
aatatttgcataacgacccattttctttggtgtagaatactagatatttttagagtaaat
tctgcaggcttttgttatttataatctagtttagtatttacaaaaaatcagtatttcatc
taattacgaccagaatcaggaccataatttttttttgtctcttttgctttgcctctttag
ATATTCTAAGACTGAAATTAGAGAACAACATTGACATCATCGATCAGCTTAACACACTAT
CTTCCCTGACAGTAAATATTTCCTCTTGTGTATTATATGACCGTATTCAGGCAGCAAAAA
CCATAGATGAAATGGAGAGAGAGGCTAAAAGGCTCTACAAAAGCAACGAACTCTTTGGAA

gtaagtgctgttctattagggtttgagcatctctttgtgctaaaattggccaaattcttt
cctcatgtctttcatccagaactcagaaaactagtgtgggggtccttaggtcctctgatg
tccttagaaaagagaacctttcatgtaggcaaccaactataatctctaagtatgtctaat
EXON 22  316 bp
ttgaatttctgaggttgacacctccaattaaccatgttttctgtaaattaagaacctgaa
cctactgtcacattactaactcaattgactgtttggctgtcccctctgtgtactctccaa
acaatgaataacgtcaaccataaaataacctttctgctgttgttgccattttatttttag
GTGTTATTTTTAAGCTTCCTTCTAACAGAAGCTGGCACAGAGGCTATGACTCTGGAAATG
TCTTTCTTCCTCCTGTCATAAAATATACCATCCGGATGAGTCTCAAGACCGCACAGACCA
CAAGAAGCCTAAGAACCAAGATTTGGGCTCCAGGGCCACACAATTCTCCATCACACAACC
AGATCTATGGCAGGGCTTTTATTTATTTACAGGATAGTATTGAAAGAGCAATCATTGAAT
TGCAAACTGGAAGGAACTCCCAGGAAATAGCAGTCCAGGTTCAAGCAATTCCTTATCCCT
GCTTCATGAAAGACAA
gtaagtgtgtgcacttccagcctttttaatgatcaacaacttttctgagaactcacttca
gtccattcattcagatgtattacatgaaaggaacaacattcaccaaacttttgtaatatg
cttgttttgagaaagagttcacactatagggcatagcttcatcataactgctcatcaata
EXON 23  115 bp
gacctatggttaaatcagcttcatgcttcgtaaataatggggtaataccgattattttca
atttcaaaacacgatcataagttcaatgtaagagagagtgagttctttatatattataat
ctctgcaagtatggtgttcattttggtcgctgaatttttctttttttgtttgttttacag
CTTCCTAACCAGTGTCTCTTATTCTCTTCCAATTGTGCTTATGGTTGCCTGGGTTGTATT
TATAGCTGCCTTTGTAAAAAAGCTTGTCTATGAGAAAGACCTCCGGCTTCATGAG
gtatgttgaaaatcacttcttgttatgaataagtcctgttcatagaacaattactatgat
tttcatcatgcctttataaacttcagaaagcctaacttatcccttgtgaattaaacagaa
agaaaaaccttttacaaatcacaaaagcagctgataaggcaatattttattttctcaaaa
EXON 24  330 bp
ggtgtatataggcatatttcacatagcaagcatggataaattcttgatttatgtaaatta
ttaaaatgcctagttccatatacagagagactatcatgacattttgacataatacaggga
ataatttttatttggaagaatatcagcataacaagcgcctcacattttttcttcttacag
TACATGAAGATGATGGGTGTGAACTCCTGCAGCCATTTCTTTGCCTGGCTTATAGAGAGT
GTTGGATTTTTACTGGTTACCATCGTGATCCTCATCATTATACTCAAGTTTGGCAATATT
CTTCCTAAAACAAATGGGTTCATTTTGTTCCTGTATTTTTCGGACTACAGCTTCTCGGTT
ATTGCCATGAGCTATCTTATCAGTGTCTTCTTCAACAACACCAACATTGCAGCTCTGATC
GGAAGCCTCATCTACATCATTGCCTTCTTTCCATTTATTGTTCTGGTTACAGTGGAGAAT
GAGTTGAGCTATGTATTGAAAGTGTTCATG
gtaagtcaaccgttggaatggcagagtgggaaattacccatttttgtttgtttgtttgtt
tgtttttggattctcagactgaaagttcacttatcttaatttgaaattcagtgaaagcaa
agtaagcttaatgtcctaatgatagcttttcttacatcactgtataccatacaagacaat
EXON 25  70 bp
tgctcttgcttcacagttgtagcatggttggtaagggactgctgtatttttaaatatgct
tagagaatgagcatcaattttatctatacaaatgtccaaagttttaagtattttaggata
cctctgggtgaaatacatgaaatctacaagaactatcattgccgtttcctttcttcacag
AGCCTGCTGTCCCCAACAGCATTCAGCTATGCAAGCCAATACATTGCACGATACGAAGAA
CAGGGCATTG
gtaggtcccctttctttaaaactggattttatctttcacaactgtgctgtgtgtcacaga
agaataaacacttgtgttcactttttaggtcttcagtgggaaaatatgtacacctccccg
gttcaggatgacaccacctcatttggctggctgtgctgtctaatcctagctgactctttc
EXON 26  135 bp
ttgccgtttcctttcttcacagagcctgctgtccccaacagcattcagctatgcaagcca
atacattgcacgatacgaagaacagggcattggtaggtcccctttctttaaaactggatt
ttatctttcacaactgtgctgtgtgtcacagaagaataaacacttgtgttcactttttag
GTCTTCAGTGGGAAAATATGTACACCTCCCCGGTTCAGGATGACACCACCTCATTTGGCT
GGCTGTGCTGTCTAATCCTAGCTGACTCTTTCATTTATTTCCTTATTGCTTGGTATGTCA
GGAATGTCTTCCCAG
gtatgaatgtgcttcctacagatacatgctttttatggttgacttcaatataaatcaact
aataatatgttctaatattttatttgcaaaaaatttttaaattaaaaaataaaaatatta
tatatatatatatatatatatgtatgtattgagatggagtctccctctgttgcccaggct
EXON 27  147 bp
caaggaaaaaaagcatcgttttttgctttactatggaaactgagaccaccttttagtttt
atatagtgtcaaaaaataaaactacttcctaaaccatacataggatctactgttttgttt
ctgatgataaatgttaacagtcaactaaaactcactgttcctgatatatttttattccag
GGACATACGGTATGGCAGCTCCCTGGTATTTTCCAATTCTTCCTTCCTATTGGAAGGAGC
GATTTGGGTGTGCAGAGGTGAAGCCTGAGAAGAGCAATGGCCTCATGTTTACTAACATCA
TGATGCAGAACACCAACCCATCTGCCA
gtaagacaagtcggtcaacagcgtgctttgttatgagagaaatgatatgaaattacatga
ctagtagtttcaattatttttttctaaatggcaaaattatcatccttttagtcatggatg
aaaatgtctacacatgcgtctttggactcttatggggattaaattgtggctttttctggg
EXON 28  191 bp
attcattctgcaaccaagtgaggaggctgaagactataataaatcatttgtttctggatt
ttttattttacttagagggttatatttttatagtcttaaatttttaataaagataaagtc
taactctagctgcattaccttacttgtgagtttacaactcttcccttgatttctctccag
GTCCTGAATACATGTTTTCCTCTAACATCGAGCCTGAACCTAAAGATCTCACAGTCGGGG
TTGCCCTGCATGGGGTCACAAAGATCTATGGCTCAAAAGTTGCTGTTGATAACCTCAATC
TGAACTTTTATGAAGGGCATATTACTTCATTGCTGGGGCCCAATGGAGCTGGGAAAACTA
CTACCATGTAT
gttaactttttgacatttattgccatggaagcatgttacaaaaaatacaggtgtaaaaaa
aataaactaacctatgtttataaaacataaagttattacatttcccagatggaggaagat
ggttcaacttgtatgctatagaatggagtcaaaatcaaaggttgtaatactttaaaaaat
EXON 29  213 bp
aaaaacttaaaagtaatatttcttattcccattaaataccattttatttcatagtttgcc
cttgactgagaagatacactgtattttttccttctaacaactgagatatagttattccta
atatctagcttcaatgcttggcttatacctaatttatcatttcttcatttccagttccat
GTTAACTGGGCTGTTTGGGGCCTCAGCAGGCACCATTTTTGTATATGGAAAAGATATCAA
AACAGACCTACACACGGTACGGAAGAACATGGGAGTCTGTATGCAGCACGACGTCTTGTT
CAGTTACCTCACTACTAAGGAGCACCTTCTCCTATATGGTTCCATCAAAGTTCCTCACTG
GACTAAAAAGCAGCTCCACGAGGAAGTAAAAAG
gcaagttaagacaggaatgagaacctaagttgctaactcctctcaaagacccatagcttg
gttggtaaagttctggtaatgataccaataggaaatattttctcacgaaataattacttt
ttagtttttctacttatttaatattgcaaacatttaaggtcattatccttaccggccagt
EXON 30  197 bp
aattttgtatccaggtgataaataatagaaaactatattatgaatcctcaagagtttatt
gtaccttactgagcacataatagttacctagtgaatacatatcaattagggttattgtat
gtttccagtactcaaatagtatatctgtaaaaaaataaccatcatacattatttttgaag
GACTTTAAAAGATACTGGACTATATAGCCATCGTCATAAGAGAGTTGGAACACTGTCAGG
AGGCATGAAGAGGAAGTTATCTATATCCATAGCTCTCATTGGTGGATCAAGGGTAGTAAT
TTTGGATGAACCATCTACTGGAGTTGACCCATGTTCTCGCCGAAGTATATGGGATGTTAT
ATCCAAGAACAAAACTG
gtatgagtagtttctcagaacttctccacccaacagtcatacttctgccctctggcatat
acaaaagcaaactgaggctgggtgcagtggctcacgcctataatcccagcactttgggag
gccaagacaggaggattgcttgagcctgggagtttgagaccagcctgggtaacatagtga
EXON 31  161 bp
cctggccctgaatttttcttgcatcattttggaagctctttgaggtcagtcagtttttca
gttagctcatgaaatgtgactcttctcagatgtcacaggatttactctggccaactctgt
gtgtcttgggaactgtactttcacgtttcattccctgttgttcttgtctgtattttcaag
CCAGAACAATCATTCTGTCAACGCACCACTTGGACGAGGCTGAAGTGCTGAGTGACCGCA
TCGCCTTCCTGGAGCAGGGTGGGCTTAGGTGCTGTGGGTCCCCATTTTACCTCAAGGAAG
CCTTTGGCGATGGGTATCACCTCACGCTTACCAAGAAGAAG
gtaggaatgggagaaaatatatctcattatggcaccataaattaagttttatatgaaata
ggagcagagtctctccaactttattcattgctaaaattcattagtatactagcttactgc
ttctcatatttgagtgagcatcgaaatcctggaggtcttgactaaaacccagagttctgg
EXON 32  237 bp
agaatggggccagtagaatagggacccaagtggcaaaggggtctctagagcagtgatgtt
atgatctgactcaggtgtggagtggcctaaaagagctcatcacctcaccctctgattagg
gcctggagcactatagtgtaaagagaggagagtgttttaattcctacttttctctcttag
AGTCCAAATTTAAATGCAAATGCAGTATGTGACACCATGGCCGTGACAGCAATGATCCAA
TCACATCTCCCCGAAGCCTACCTCAAGGAGGATATTGGGGGAGAGCTTGTTTATGTACTT
CCTCCATTCAGCACCAAAGTCTCAGGGGCCTACCTGTCACTCCTACGGGCACTCGACAAT
GGCATGGGTGACCTCAACATCGGGTGCTACGGCATTTCAGATACCACCGTGGAGGAG
gtatacctcaatatttcttttttttcttcaagctgatataacttgctgttccctttgaag
aaatatgtgccatttttctaaaaaaatttttaaaatagttcacaaaattagaaaagctta
acattttttcagtactattcttatgtaagactgagaataaaatgttgccccagctagaca
EXON 33  151 bp
taaaatgttgccccagctagacagcacgtatcttttacatacagaaatattcacttgaag
tcagacgggaaaaatttgtctcagtaaatgtgataaaagttcaaaatcaaaggtaagctt
agaaatgagaaaagacatgcacttttcatgttaatgaagtgatctggcttctctttctag
GTCTTTCTGAACTTGACCAAAGAGTCACAAAAAAATAGTGCTATGAGTCTTGAGCACTTA
ACACAAAAGAAAATTGGGAATTCCAATGCCAATGGCATCTCAACTCCTGACGATTTATCT
GTGAGCAGCAGCAATTTCACAGACAGAGATG
gtatgaatctaatgtggatattttgtttaattccaatggatgacataaatgagaaaaatc
acagacagactttgatttttaaaaattcaactctaaagtttcattctaaattcaaaaaac
actaaggaaatttaagcctccttttttaagatataaaatattcattaaaccaaatcgaat
EXON 34  253 bp
gttttcccaatggaaggtccaaggctaaggctgagaaataacattgctgaacctcaaatc
caaatctttaaaagcttttcccaccacagtgtattataccatttatatatagtttctgaa
gttattttattgcttatcaagatttcccagaaccatatccaatctctttttcttaatcag
ACAAAATCCTGACAAGAGGAGAGAGGCTGGATGGCTTTGGACTGTTGCTGAAGAAGATCA
TGGCTATACTCATCAAGAGGTTCCACCACACCCGCAGGAACTGGAAAGGTCTCATTGCTC
AGGTTATCCTCCCCATCGTCTTTGTTACCACTGCCATGGGCCTTGGCACACTGAGAAATT
CCAGCAACAGTTATCCAGAGATTCAGATCTCCCCCTCTCTTTATGGTACCTCCGAACAGA
CAGCCTTCTATGC
gtaagtttctttctgttaactaaaagaatgtttccaaaatgcttccaggagtgtggttgt
acctgaatgaaggccatgagatctggagaataaagtacttagaagccatggtacctgatt
ctgctaaaggaatgaacagtttgattgattgcaatatgttacttctattgccaacaaata
EXON 35  87 bp
tgcattgagccgtgtgattgcactactgcactccagcctgggcaacacggcaagactctg
tctcaaaaaagaaaaagaaaacccttctatatacagcacatttcatttcttcaagcatga
ttttaatatgggagactagtagaaaaatcatgaatttgtttctgtcctttcatattgcag
TAATTATCACCCGAGCACGGAAGCACTTGTCTCAGCAATGTGGGACTTCCCTGGAATTGA
CAACATGTGTCTGAACACCAGTGATCT
gtaagtggttcttgctcttctattttttgttttcagcattccagtttgagtgtgtgcatg
tgtatgtgggtgtgtgtgtctgttatttgcctggaagaaagctgtaccctgatagaaatc
cctgtttaacagattttgtctatctcctttagttcatttcttagttatcctatgctatac
EXON 36  94 bp
acaaaacgtcaaatcatttggaaatggtggagcaatgtacactgaagttatgaaaaatca
gtaaattgttctgtgactacacacatgaacttaataccaaatacttgtttacatgctcat
atgtaaacatgagaacacatatacatacacacctcacagcaatatcattttaacttgcag
ACAGTGTTTAAACAAAGACAGTCTGGAAAAATGGAACACCAGTGGAGAACCCATCACTAA
TTTTGGTGTTTGCTCCTGCTCAGAAAATGTCCAG
gtaagatggaattcagtttcagtgaaatgggaaaaatacgggaataaatatcgaaagctc
gaaagatctctctaggttaccaaagaatcagtataagttcattttatggaagctagtagc
tcagaaatatggatctgggcagctcaaaaaatactgactttgaacatcagcttactgttt
EXON 37  128 bp
atttcttggtgtaggtgagatgacttctttttcaaagctctttagagtcaaaggacagtc
ttatcacactctaccagttgcagtaatagacaaatcatgagactgaagctccttgacatt
gtctatttaacttgcacagcattggccagaaaaaaattcatttttaactttattttccag
GAATGTCCTAAATTTAACTATTCCCCACCGCACAGAAGAACTTACTCATCCCAGGTAATT
TATAACCTCACTGGGCAACGAGTGGAAAATTATCTTATATCAACTGCAAATGAGTTTGTC
CAAAAAAG
gtaaaataatctgtttataacatatttaattgcttgctaattttaatggtagctgccttc
taaagagacaatagatacaaatttctattgtttacattttacatggttaaattctcagtt
ttatttaaacagccttatatattgaaatgtaaataatgactctaaattaagatttatttg
EXON 38  88 bp
actgaaatatgataaaaagaattgatagaaatgtaaaatatttgtcaggaagtattcatt
ttatactgtaaatgtgttcctaacagaaacaaaaagttgagctcctcgttaagtatttta
gatctatttaagaagattttctccactaaaccaaagatatatttttattactctctgtag
ATATGGAGGTTGGAGTTTTGGGCTGCCTTTGACAAAAGACCTTCGTTTTGATATAACAGG
AGTCCCTGCCAATAGAACACTTGCCAAG
gtaaattttgatcttttttctggaatgttatacaaatgagaaggtgaaattgatatgttt
aatcattttcatgaagtgaaaacaaaatatgggtacaatcgatttggcattgtgcataac
ccagggcacagtggttccaattctgtgtatgtaccctagggaagcatgtacacattagca
EXON 39  106 bp
ggaaatttataggcctatggtcagtactctagagaacagtgcataatcttccaagataaa
ataaattattggaaaattgatgctcttattttaaatataaataagatagctgtcagatgt
taagacagcctaatttatttgaatgcaatattgatcttgccttcttttggaatttaatag
GTATGGTATGATCCAGAAGGCTATCACTCCCTTCCAGCTTACCTCAACAGCCTGAATAAT
TTCCTTCTGCGAGTTAACATGTCAAAATACGATGCTGCCCGACATG
gtaaagttactaacacaaaagtgtcctgtattgcaacttctgttactctttgtataaaaa
tgcactttatatcctgtttcttcacaggtggcaggtattttatggtatctaaatcacagg
tctttaaaaggagtttagaagtagtaactatcgccagatgcaacattctggataatcctc
EXON 40  55 bp
aattgtatggcattaatgggattaggggaaaaataattttcctttaaaaaaaaaaggtcc
cccaaataaaattgtttagataataatataaggaggaaagtgttgaatattattcatcta
aaaattggtatttctgattaactgaatacctactaatagaagaactgtttcgtctttaag
GCATCATCATGTATAGCCATCCTTATCCAGGAGTGCAAGACCAAGAACAAGCCAC
gtaagcagatatctctagcatgactactttctccttgacatagctgagcctttgtataaa
gtgctgtaattggaaatcacagttgtatctgaatgaatgtcaatctagaagggctggtaa
tatgtcactgactgggatcaaaggaagtttctgcaagggtgtagagtgggcttgccaagt
EXON 41  178 bp
attctagggtcatggtagagtcacgttggaaatattatctggctgccttgcaggatgcct
tatttgtgtcacagccaactcttgtactgttttcttgatggttttagttatgaatctttc
tgaaaggaaaagagtttcaaaaacttatgtgtgttttcctctccctattgctcactctag
AATCAGCAGTTTAATCGATATTTTAGTGGCACTGTCTATCTTGATGGGCTACTCTGTCAC
CACCGCCAGCTTTGTCACCTATGTTGTAAGGGAACATCAAACCAAAGCCAAACAGTTGCA
GCACATTTCAGGCATTGGCGTGACATGCTACTGGGTAACAAACTTCATTTATGACATG
gtgagtaacttatgtccttcattgcagggaataaaagatcaatttggatagaagacatca
gttttctattcaagagttatttactctagtttgttcaaattgttatcacaaagacaggaa
ataaagaaaatgacttgagtcaggcttatcttcatccagtggttggaggaaacataacct
EXON 42  116 bp
aaagtgaaatcaatgtaaaataagttgaatgttagaagcaatgggaacataaataagaat
tcatttcttcaaatttttctaggtcaacttgttgcagttttaaactagatgggttattga
tttttttttttttgaaaaatgcttgtcacgtattaaacattgttttgaatatttccatag
GTTTTCTACTTGGTGCCTGTAGCGTTTTCAATTGGTATCATTGCGATTTTCAAATTACCT
GCATTCTACAGTGAAAACAACCTAGGCGCTGTATCTCTCCTACTTCTCCTGTTTGG
gtaagctgctgattaagcaatgaaagaagaattaatagaattaaatgcccctagacacaa
ataggacttaaatctcattagctaaattacaattgtcttggggtttcatttgacatgagt
gatgactaacaacacattgcacttgctagtccatagactgcaaagtataatacttttgaa
EXON 43  160 bp
ctggctgattttcatatttttctgtagagacagggttttgccaagttgctcaggctggtc
tcaaactcctgggctcaagtgatccacctgcctcagcctcctaaagtgttaggattacag
gtgtgagccaccatgcctggccgaggcgtaattttaattctttgtgtttttaacctgcag
GTATGCAACATTTTCCTGGATGTACTTGCTGGCTGGGCTCTTCCATGAAACAGGAATGGC
CTTCATCACTTACGTCTGTGTCAACTTGTTTTTTGGCATTAATTCCATTGTTTCCCTGTC
AGTGGTATACTTTCTTTCCAAGGAAAAGCCTAATGATCCG
gtaaggtcccttatttcagtgaatttatcaaaagcttcaacatgttccaggtggaaagat
tttatttattctacataaaaaagaagaatatcatttgattctattaaatttgggagagga
gaaactacagcttttaaaattctttttgggcctcatctaagttaatgcctatcattgtat
EXON 44  254 bp
aaacatccaccatttagtatactaaatatttgtatgcaaattcagcctatatgggaaata
attgccaatctagataagctttttaggtttcactatttgtctacatccatctagttttaa
atttttgtcagctttttggaaacttaacactgagttttatttttatttctcttatttcag
ACTTTAGAACTTATTTCTGAAACCCTCAAGCGCATTTTCCTGATTTTCCCACAATTCTGT
TTTGGCTACGGTTTGATTGAACTTTCTCAACAACAGTCGGTCCTAGACTTCTTAAAAGCA
TATGGAGTGGAATACCCAAATGAAACCTTTGAGATGAATAAACTAGGTGCAATGTTTGTG
GCTTTGGTTTCTCAGGGCACCATGTTTTTTTCCTTGCGACTCTTAATCAACGAATCCCTG
ATAAAGAAACTCAG
gtaaatataatgaaaacataacgtttgacatctaaaacagaactcaattcaacctattga
gaaagaagtcaatagtctaagcttttccattggtaatatggaaatgtttggctcaaaaac
ttttaaaaaattctagcataattcactatttattttattctagtaagtagttatcaaatc
EXON 45  205 bp
tacagtgaggagggtctatactgatttaagttatctgagtagcataattcattacaaatg
taaaagaagtctaatgatgactagtacactgttagtgacatgaaaacccatcaaaacatg
tcaaaattgaatgctgtcatttcaaaatcattgacgtaaaatcactgggtccatttttag
GCTTTTCTTCAGAAAATTTAATTCTTCACATGTAAGGGAGACAATAGATGAGGATGAAGA
TGTGCGGGCTGAGAGATTAAGAGTTGAGAGTGGTGCAGCTGAATTTGACTTGGTCCAACT
TTATTGTCTCACAAAGACCTACCAACTTATCCACAAAAAGATTATAGCTGTAAACAACAT
CAGCATTGGGATACCTGCTGGAGAG
gtaagaaactgtgttttgtttctaactgtccttttcattggcatactatgtgacaaatta
aaatcttaattattggccaggtacagtggctcacacctgtaatcttagcactttgggagg
ccgaggtgggtggatcacttgaggtcaagagtttgagaccagcctggccaacatggtgaa
EXON 46  110 bp
ggtatccatttgttttaaaaaagaaagttttatcaagagcattacactatccatgaataa
ttccagagatttatttttctcggtaatttatttcacccagggagaagagggagagataca
aaagcaatgtctcattggtttggattaaggcttatatcttctttttctccctcaaaccag
TGTTTTGGGCTTCTTGGAGTGAATGGAGCAGGAAAGACCACTATATTCAAGATGCTGACA
GGAGACATCATTCCTTCAAGTGGAAACATTCTGATCAGAAATAAGACCGG
gtatgaaaaactaatgcttcaatttagcgagtacaacatacttaaatgagaaaaataatt
gaaatgaacatttaatgttattttgtggttatattattcagtccttaggggagaacaaag
ctattaaggtgggtggaaatgtttaaatgtttaaatgtgaatttgatagtgggattattt
EXON 47  142 bp
attaaggtgggtggaaatgtttaaatgtttaaatgtgaatttgatagtgggattatttta
tccctttttatcaaagtcactgaccaccatgaccaaaatagagctaccttcccagcattt
gggaaccaggagggataaatcttttgaaattcatctgtgtttttgattctctcaattcag
ATCTCTGGGTCACGTTGATTCTCACAGCTCATTAGTTGGCTACTGTCCTCAGGAAGATGC
CTTAGATGACCTGGTAACTGTGGAAGAACATTTGTATTTCTATGCCAGGGTACATGGAAT
TCCAGAAAAGGATATTAAAGAA
gtgagtacaagtgtgaaaaattacttaatttgaaaccattattgtttctacttccatccc
ccaccccaccacacccactgtcccccctgccccaccatttcccctcaaaaccacctggaa
aacattgtcattttccttctggcagtggcaatggcagtgagtccctcttagtttggtcat
EXON 48  135 bp
taatccttaagtgattctttgaaaataaaatctatgttgaatttaagtgttttcattttt
ttccagatatattctccatgataacattttcttttcatgagcatcttttttttttccatt
tagtgctttaagggttttggcacaggaaggtcaacctaactccccttttattgcctacag
ACTGTTCATAAACTCCTTAGGAGACTTCACCTGATGCCCTTCAAGGACAGAGCTACCTCT
ATGTGCAGTTATGGCACAAAAAGAAAATTATCCACTGCACTGGCCTTGATAGGGAAACCT
TCCATTCTACTGCTG
gtaagagaatcattatttaaacaggccactccataattagaacagcatatctgattgcat
gtgttaacatttcatcatcatgattgcagtcaacatttattgaggtctcactatgtgcta
gctattgtgcaaagcactttatgtatactatctcaataaaggattttatatcagcaaata
EXON 49  104 bp
aatgattaattttgaactttttgacagcagcagaaagaagtctattaagtataaaacaag
ttagtcacaggacctcgaaaagtatttctgttctagggaagtgaaatgcagtaattcatg
aaaagaacttcatcaaaaattaattaatttgataaatttttgttgtaactttctattaag
GATGAGCCGAGCTCTGGCATGGATCCGAAGTCGAAACGGCACCTCTGGAAGATCATTTCA
GAAGAAGTACAGAACAAATGTTCCGTCATCCTCACATCTCACAG
gtaaactgagtggaatctttaaagcgaatccacacagtcttaggatgacaggtgggaaaa
ggtaatcctgtataacataaataaatatatacacatacatatatatgtgtgtgtatatat
atatatacacacatacaaaatatatacacacaaatatatgtatatatatagacaacgaat
EXON 50  93 bp
ccactgcactctagcctgggcaacagagtgacaccctatctcaaaaaaataacaaagaaa
agaaaaaaactaaaatagtatttccaagtgccataatgaaacaattatgcttatgctcat
gaacttcaacccaagttttctgtatcctgaatgctaatatgatcctgctttgtcttttag
CATGGAAGAATGTGAAGCTCTCTGTACCAGGTTGGCCATTATGGTGAATGGAAAGTTTCA
ATGTATTGGATCTTTGCAGCACATAAAGAGCAG
gtgaagaacaaatgcattgcttaacagatagtgttgggtcatctatctaatggtgctcac
tcagattcaaggattatctcagcagcctaagtagtaaaactagaatggacaagctaatct
ttggaagctagtcactgactcaccttaaatttaaattattttattggggatttgatgaat
EXON 51  106 bp
tagcagtgcactatttccagtttgcaacatgtcctgaacttttatggcaaaatgatagtc
ttcatataaagaaaaggtgatataatggttggcttgggtcctgtttcattatctagaatt
ccagaggagctatttcagcaaaatgtaattcatatcatattttgcactttttctttctag
GTTTGGACGAGGATTTACTGTCAAAGTTCACTTGAAGAATAACAAAGTGACCATGGAGAC
CCTCACAAAGTTCATGCAGCTGCACTTTCCAAAAACATACTTAAAA
gtaagtgatgatggctgggtgcagtggctcacgcctgtaatcccagcactttgggagtcc
gaggcgggcaatcacttgaggtcaggaggttaagaccagcctggccaacatggtgaaacc
ccgtctctacaaaaaatacaaaaattagctgggcatggtggcacatgcctgtaatcccag
EXON 52  138 bp
aaactttcatctcatctttgcaagctgttagtttcaaaatatactcgttatttatactgt
agcatcattttcagtggaatgaacttcagttattttcctgaactcttggtaaagttatgt
ctagtcatgtcaacattaccagacattgcaaaataaacttttttcctttggttcccacag
GATCAGCACCTCAGCATGCTAGAGTATCATGTACCAGTCACAGCAGGAGGAGTCGCAAAC
ATTTTTGATCTGCTGGAAACCAACAAGACTGCTTTAAATATTACAAATTTCTTAGTGAGT
CAGACCACTCTGGAAGAG
gtaagatatataccacgatccatgtgcacaacgtcacatattaatattattattcattct
ggttatttctttttaattacattcaatttgtttttaattgaattaatatctagtcttgca
cctgaaaaacttagcaaagagcctaatcaatttctcacttaatttggggatattaaaaaa
EXON 53  1199 bp
tgaaaggactcctagtgcaagcatgtataaaactaggatttggattttataggggcctgc
atacacatatatacacgcttgcactaggagagaggaaggggagagagagagaatgaatta
actttattttttcctttggcttaccaggcattaatggctttattttccctgaaaaatcag
GTTTTCATCAACTTTGCCAAAGACCAGAAGTCCTATGAAACTGCTGATACCAGCAGCCAA
GGTTCCACTATAAGTGTTGACTCACAAGATGACCAGATGGAGTCTTAACACTTCCAGCAA
ACTCAATCTCAGCGTGTGACCAATGGCTTCATTTTGAAGAAAAGCCACAGAAGATACACT
TCCGCAAGATATCTTCATTTTAAAGTAAAGTAATATACTGTATGGAAAGTTACAACTGTG
TTAGACTAACAAGTAATTATAAAAGGAAATTTTTCCTTCTAAGGTCAGTGAGTGTTGTTG
CTACTGAAATGAATTCCTGTATACTCAACACTGTGAGCATGCTAATGTATATGCTGGTGA
TTCTTATGCAAAGGTGAAGCCACCTCAAGATGAATATCTTAATTTATTACTTTCAATAAA
AAGACAGTTTAAAAGGCATGGATTTTGGTAGTTGAAATATAAGAGTGGAGAAGAAAAGTC
AGATGGTTTGTGGCAGGTGCCACCGGGCAAGCAGACAACATAATTTATTTCCAGAAAACA
ACAGAATGAACATCATCATGAATACATGAATCGGCTGTGATGTGTGAACTGCTAAGGGCC
AAATGAACGTTTGCAGAGCAGTGGGCACAATGTTTACAATGTATGTGTATGTCACTTTCG
GTACCTGTGAATGCATGGGGACGTGCTGAACCCGAAAAAAAGTGCCTTTCCATAAGGACT
GCAATAGAGAGGGCAATTTACCCTGGTGGTACACGGAACCTAGATTCACTCCTGCCATGC
CTTGCCAATAGTAAGCTGCAGGGTGGAACAAGAAATCACTTGCTCTGGGGGGAAGGGAGG
GGGGAATGGGTGTGTCAGCTGGGTAGATACAAACCCTGAAAAGAGAATCCATGTGCTACT
GGCAGGCAACATTTTTTAAAGCTCTTTCAGAAACCCTCATATTTGGGGTTTCTTTTCAGG
AAACATTCCTGTGGAGGGAAAACGAATATGAAGATAATTTTCAGCTAATTATCTGGGTGA
CCCAGAATCGTGTATATGGCTATAGGATAGACTTCTTAATAATGGCAAGTGACGTGGCCC
TGGGGAAAGGTGCTTTATGTACCGTGTGTGCGTGTATGTGTGTGTATCTATACAAGTTTG
TCAGCTTTGGCATGACTGTTTGTCTCGAAAACCAATAAACTCAAAGTTTAGAAAAACTC
attcatgctgtcatttcatttgttagggaagagacaggaacctaaaaatgggagtcatgt
ggcctgcaaagtttcacttgatctggcccctgttggcctctccaccctcatccccatctt
tctctctctttggccctttgggatctagccatgctggccccttcccactttttccagtgc