--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (62058 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (18 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1396       1510   0    Initial    115    62    Marginal
gttggttcaatctctgggtaagtcgactgtgtcttcggggccgagggtcgggcggcggcg
cggccgggcgggcgggaggaggccggcgtggggcgcggcggcggcggccgcgggaagcga
gcccgggaggcggcgggcgggccgggggcgcggcgggcccacagcggagcctgcgattga
ATGGAGCCGCTTTTGCCGCTGGGGGATGGAGGCGGGGAGGCGGCCTCGGGAGGGGAGCGC
TTGCTGGGTCATTCGCGTGTGCGGGTGGCGGTGGAGGAAGGCGAGGAGTGTGATA
gtgaagcggggccccgcgcggggtgggaggggttccccagcccctggggctggggagaag
ttggggtgatttcaggaacatctctgtaaattattaggagtggaagtttccagaaatatt
tagtgcagcagcattgaaacgtccgcctgcatcacgtggccccctcggtggagagcttgg

Exon  2 +       4904       5022   1   Internal    119    86        Good
tcagcttttgttacttgcttttactatctcagttttctgtaattaaagtctctaaagtat
tcattaaaatatttgtaataacatggttgaagtaaaataacttgtaggaagtttttgata
ataccaaaacttgataggcagcttcaattttttttctttattttcagtaatctatgccag
CAATTATGACAATGTTAGCAGACCATGCAGCTCGTCAGCTGCTTGATTTCAGCCAAAAAC
TGGATATCAACTTATTAGATAATGTGGTGAATTGCTTATACCATGGAGAAGGAGCCCAG
gtaaagtagccaaccaaaactttataacattatgacagtgtaacagagttgttgggttta
gaataaaattttaaattatcacctttaaaaaagatattccatagtttgcattaatttgga
attctgtattaaccataatgaaaattggtttggagaaagaaattgcatgtttgacatggt

Exon  3 +       7051       7094   1   Internal     44    87        Good
ctcttgcagtgattctgtaagcttgttagcccaggtttatacttttagggcgttttgatc
agtatattatctcctaaagcattcttgaaaaaattaaccatccgtatttattatccctgt
catttagttgttactcatgctatacattcaacatgaagctttaagcttcatttcttctag
CATGGATGCATAGAAAGCAGCTGCTTTTGGAGGAAGCTATGAAA
gtaaggttgggttcaactctgaatgtaatattggaagcacaggtctgtagccattgggaa
aaagggcatttaattttttccgcatagattcagctactaatactgtttaatcttcacact
aaactagttcactacatctaaaggtatgataaataaaccaacatagagcagtgttcttca

Exon  4 +      12273      12374   0   Internal    102    75        Good
agtcatatttatataattttatttctatttctgtaaggtctaatttttgagtatttctga
acatcaataatagaatctctgtccaattagaatttgtgccttgctcagtagttttcattt
taatgaatgattcaaaagaatacattagcttaagttttgttttttttaataatattttag
CAAAGAATGGCTCAAGAAGTACTGACACATTTAAAGGAGCATCCTGATGCTTGGACAAGA
GTCGACACAATTTTGGAATTTTCTCAGAATATGAATACGAAA
gtaagcaagtggtggttttaaaatctgttatttcttttcttccagtcataaactttgagg
aaggtatctcatttttagtattagcatttgttatctcaaattattttatattgttaattt
gtttcaaaatttagtcttaagcatataattaattcttgcaaatagtcctaagaattatga

Exon  5 +      17886      17933   0    Initial     48    45    Marginal
tttctttaaatgttttattatggtttgaaactattttagatcacgttctgtgatggactg
agaaattaataagcacaatttgactatgtggtccaagtaggtccttcatactttattctt
cagggatctttagtgtagtcattccttgtttctttactactattgttttactcatgtgtt
ATGAGCCCCAGATTTAATTTTGGCCATGGTCTGCCGTACCAAGAAAAG
gtgatttacttctgtcccattttactgttgtataattttaaatcctccttttgttcttaa
atctgcatctctgttttttatcacatttgatggttctggaagatgttttccaggttgaaa
atagatatgattatactagtttatcaacactgtagttacatttgttacagacaaaattaa

Exon  6 +      26414      26479   0    Initial     66    46    Marginal
ccattgttcacttatctcttgaacgtgtagtttaatccagctagtcaaagcccagttcaa
actcactttcccttcctgttgtgagaaaacacctcaattttgcaaaagctcttggaattt
aacatttctgctgcttttccctgtatgtgtggtgtttagtcttttcatagttcgttgact
ATGGAATTCAGAGCAGAAACCCTATTTCCTAATTTCCTTGGGAAGTTTTCAGAACTAGAT
GATAAT
gtaagtttctaataagttgatagtgttactcagaggtgattgtttcatttatgattttga
aaagaaaatgtaaatattagacttaagtccttgcatctaaaacaaattcatgagaaatcc
cacagaatacaatgttagagatgggagcaaaaattatcagtctaatctcagagagttgac

Exon  7 +      34102      34306   0   Internal    205    82        Good
ggaaagtccataattactgttacagaaattttttatttgggatattgtgggaaatggcta
gtgttgtcatagttaataaaaattatataattaagtgccattgaagaaccatagtttgaa
agtgaatttaatacattagctcatagttatacaatctcacaagcattttgctgccttcag
GTTGTCAGTTTCCTGCTAATGCTAATGACTAAATTTTTTATTTTTCTTTTCAACGAAAAT
TTCACTCAGTTCTATATATGCCAGATGAGGCTTGGAACATACAGCTCTACAACCTTTAAC
TGCTTTTCCAAAAATCTGAACGCTATGAAAATGAAAAATCTTCATAATTTAACTGATTTG
GTGACAAAGCGTAAAGTGAACAGAT
gtgagagtatttgtaattgttaattttacgtagtaggaaatagtaatttgttcaattagg
gttgctacttcatatccttttagtgtttcaatataggtgtaccacactacttttccttta
aaaatgttctcagaatttaacattctgcaacactcttgaaccctgtgattttggagaatg

Exon  8 +      36484      36545   1   Internal     62    83        Good
agcgtgagccaccgcaccgggccggaatttttttaaaatgccaatactggtgacaggatt
agagtatattaactgattttacttagtctttccattcccacattaattagttctcaaaat
ttatttgcatgctacaaaagagctcaacaatttttttattacgtgcaatttttttaatag
GAATAAAAAAATACGTTGTTGGCCTCATTATCAAGACGTCATCTGACCCAACTTGTGTAG
AG
gtaagagtttattttggagcttattgggagagcataaaatcatttagatattgagtctga
ctacaacctaattctgtcaagacacatagtcacacatatgcacagtcagtcatttacagt
agagctgtaatcatttgttaggattgtctggttatattcttatttatacttacctcaggc

Exon  9 +      36754      36798   1   Internal     45    82        Good
agagcataaaatcatttagatattgagtctgactacaacctaattctgtcaagacacata
gtcacacatatgcacagtcagtcatttacagtagagctgtaatcatttgttaggattgtc
tggttatattcttatttatacttacctcaggctctcatttaatcttttacttttccttag
AAAGAAAAGGTGTATATCGGAAAATTAAATATGATCCTTGTTCAG
gtaagctttaacttaactgttttccttagaagaattatgcttattatttgaacaaaatgt
tcgacctacttaggaaataaagtatactaatattttgcagaagtagtgatagtattctta
taataataggtaacctactgtctagtacttgaatgttaatttgctgtggcagtaatcatc

Exon 10 +      41787      41915   0   Internal    129    52    Marginal
taggcaataaaattccctctcagtatatctgcatgataaaatatgttcattcacttggcc
tgtttttgacatctacccctatatttaattgttaaagcctttttccttttaattgtgaat
tttaagtaaagtgtgtatcaggccaattaattttatggttccctccccccttttaaatag
TTCCTGAATGTTCCAATGTTTCGAAATGTCTCTCTGAAGTGCCTCACTGAGATTGCTGGT
GTGAGTGTAAGCCAATATGAAGAACAATTTGTAACACTATTTACTCTGACAATGATGCAA
CTAAAGCAG
gtaatataatactatcttgaaaattggctgaataattttagtgccttagaaaataccaaa
ttccaaatgagttattttagaacgacgtatcaaagataagccataatcttttgtttatta
cataaaatttgtagtaagctacaaatttttatgatgtttccaaaaatttcttaaaattca

Exon 11 +      43181      43339   0   Internal    159    87        Good
ggaggggctgaggaggactgattgggcctaggaggtggaggctgcagtgagctttggtca
taccactgcactccagcctggacagagtgataccttgtctcaaaaaaataataataaaat
attaagtgtctttagttgttttataaaatgcgaactgatcgtcccttttaaaatttgcag
ATGCTTCCTTTAAATACCAATATTCGACTTGCGTACTCAAATGGAAAAGATGATGAACAG
AACTTCATTCAAAATCTCAGTTTGTTTCTCTGCACCTTTCTTAAGGAACATGATCAACTT
ATAGAAAAAAGATTAAATCTCAGGGAAACTCTTATGGAG
gtaagatatgtggagcttttgctcctaaaattctgctctgcctactaataactcttaaaa
gtgcctttttctaaaatgtatgtaccttttgagatttcttattacttaatatttgatcag
tacattatatatattctcaattctgaattacagttataagcccagttttctgattttatg

Exon 12 +      45765      45879   0    Initial    115    52    Marginal
ctcggccctccggaatagttggaattataggcatgaatccctacacatggctggcttgtg
gtttttttggttttgtttgtttttaactaagcttctacactaatgatttcagtgatctaa
cgatttttttcttgattgatatattgttgagtataggtccgtttattaatggttagtcga
ATGGCTAAACCAGAGGAAGTATTGGTTGTAGAGAATGATCAAGGAGAAGTTGTGAGAGAA
TTCATGAAGGATACAGATTCCATAAATTTGTATAAGAATATGAGGGAAACATTGG
gtaagttaataaatactgttaatctttacctttataaatctattctggggtggaaataca
ttttaggaaatgtacttgtagtttctaaatattttctaaatgtattgttactcatcaata
aaattctgctcattatttgcatttgaaaccatgtttttctttgtagtttatcttactcat

Exon 13 +      46046      46227   1   Internal    182    73        Good
gagggaaacattgggtaagttaataaatactgttaatctttacctttataaatctattct
ggggtggaaatacattttaggaaatgtacttgtagtttctaaatattttctaaatgtatt
gttactcatcaataaaattctgctcattatttgcatttgaaaccatgtttttctttgtag
TTTATCTTACTCATCTGGATTATGTAGATACAGAAAGAATAATGACAGAGAAGCTTCACA
ATCAAGTGAATGGTACAGAGTGGTCATGGAAAAATTTGAATACATTGTGTTGGGCAATAG
GCTCCATTAGTGGAGCAATGCATGAAGAGGACGAAAAACGATTTCTTGTTACTGTTATAA
AG
gtatgcaagggataggtatgaattagaattgctaaataagtattatgttgttacaataaa
taatacaaatttgtcttatttacaggatctattaggattatgtgaacagaaaagaggcaa
agataataaagctattattgcatcaaatatcatgtacatagtaggtcaatacccacgttt

Exon 14 +      46574      46759   0    Initial    186    68    Marginal
caatacccacgttttttgagagctcactggaaatttctgaagactgtagttaacaagctg
ttcgaattcatgcatggtaaatctctttctttactatattttgcttttatttttattgaa
gaaaataaatgaatgtttttgtcttgttagagacccatgatggagtccaggacaaaataa
ATGAATATTTTTGTCTTGTTAGAGACCCATGATGGAGTCCAGGATATGGCTTGTGATACT
TTCATTAAAATAGCCCAAAAATGCCGCAGGCATTTCGTTCAGGTTCAGGTTGGAGAAGTG
ATGCCATTTATTGATGAAATTTTGAACAACATTAACACTATTATTTGTGATCTTCAGCCT
CAACAG
gtatgttaagcactgagcatatgttatttttagaaagtaacacttgtatcaatctgtatg
tatcaatggaaataggagggcaactattggatccaatagaagtgtttctgattaaatttt
ctttcttttttccttgagacagggtcttactctgttgcccaggcttgagtgcagtggcac

Exon 15 +      48018      48152   0   Internal    135    93   Excellent
tctgcaactcctgaccacaagtgattggcctgccttggcttctcaaagtattgggattac
aggagtgatccactgcacctgggccaaaatcagtttcaagacgtttgtgaattgcttgtg
tgtggttttccttattagggtgtataacataaacgttaaaatgtctgctttttaaaatag
GTTCATACGTTTTATGAAGCTGTGGGGTACATGATTGGTGCACAAACAGATCAAACAGTA
CAAGAACACTTGATAGAAAAGTACATGTTACTCCCTAATCAAGTGTGGGATAGTATAATC
CAGCAGGCAACCAAA
gtaagtatttctaccttttcttaaaagttttcatgggatttaacaagacgtgttctttac
aaatgtattgaattcaagccttttaacatgtatgtgtgatccataagtgcttttatgtgt
gtctttctataatttattatctgggcgaggtgtggtggctcacgcctgtaatcctggcac

Exon 16 +      52832      53026   0   Internal    195    83        Good
gatttcctgctttcttttgctaaaaactgttttgacgtaggaaaccctaatacaaacaca
agattttcctgttttcagtagatgatcatgctacatctcatagacaggaataaccttgtt
gtttaaaatagtcaccatgtacctaaattaaaacataacttttttttccctccccaacag
GTCGCTGAAAATTTTGTTCCCCCTCTGTTGGATGCAGTTCTCATTGATTATCAGAGAAAT
GTCCCAGCTGCTAGAGAACCAGAAGTGCTTAGTACTATGGCCATAATTGTCAACAAGTTA
GGGGGACATATAACAGCTGAAATACCTCAAATATTTGATGCTGTTTTTGAATGCACATTG
AATATGATAAATAAG
gtgtgtaatatttcagttatgtaagggggaaattctgcaggatagccttaattcttgaaa
gctaaagtatgtctgtggatataacataattttaatgccatggagtttaaatatttaaac
ttgtatattagggaaatactttcttggttttcaagaacttacttcccaggagtttgaaac

Exon 17 +      54689      54857   0   Internal    169    55    Marginal
ttcattttccgtgagaggtggattgtattttacttgggtttacctttcaggaggcattct
atcttctgtggtttattgaaaactccaaatatttatactggattaagccttgcttttccc
ctcctgtctagcacaacaaagacactgaaacattattttgtttccaccacttatttttag
GACTTTGAAGAATATCCTGAACATAGAACGAACTTTTTCTTACTACTTCAGGCTGTCAAT
TCTCATTGTTTCCCAGCATTCCTTGCTATTCCACCTACACAGTTTAAACTTGTTTTGGAT
TCCATCATTTGGGCTTTCAAACATACTATGAGGAATGTCGCAGATACGG
gtaaataaaagatgttcttttattcatttgcctgccaatccaaaaatacaaatatagtta
attgtacataggaaggtattacttgttcagagttttgagtgtgtgaattacatatatgaa
catctgagaaaatcctataagcagtttaatcaactgttccactccactccaagtgagtcc

Exon 18 +      59828      59974   0   Terminal    147    96   Excellent
aggtttgcagttcattcagctatgtagtatactgtgtcactatcctataatttaaaaccc
agccactttatggataatttatattccttccttctctaaaaaggaaattgctcatctatg
atttctttctttgcaagttgaagtttattgcgttgacatttcaactatctgttttcacag
GAATTTGCAGGTGAAGACACTTCTGATTTGTTTTTGGAAGAGAGAGAAATAGCCCTACGG
CAGGCTGATGAAGAGAAACATAAACGTCAAATGTCTGTCCCTGGCATCTTTAATCCACAT
GAGATTCCAGAAGAAATGTGTGATTAA
aatccaaattcatgctgttttttttctctgcaactcgttagcagaggaaaacagcatgtg
ggtatttgtcgaccaaaatgatgccaatttgtaaattaaaatgtcacctagtggcccttt
ttcttatgtgtttttttgtataagaaattttctgtgaaatatccttccattgtttaagct

--------------------------------------------------------------------------------