--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (101616 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (16 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       7902       8076   2   Terminal    175    60    Marginal
tgagatatgttccatcaatgcctagtttattgagagattttaacatgaagggatgttgaa
ttttattgaaggcctattctgcttctattgagataaccatgtggtttttgtcattggttc
tgtttatgtgatggattatgtttattgatttgtgtatgttgaaccaaccttgcgtcccag
GGATGAAGCTGACTTGATCTTGGTGGATAAGCTTTTTGATGTGCTTTTGGATTCGGTTTG
CCAGTACTTTATTGAGGATTTTTGCACTGATGTTCATCACAGATATTGGCCTGAAGTTTC
TTTTTTTGTTGTGTCTCTGCCAGGTTTTGGTATCAGGATGATGCTGGCCTCATAA
aatgagttagggaggagtccctccttttcaattgtttgaatagtttcagaaggaatggta
caagctcctctttgtacctctggtagaattcatccatgaatccatctggtcctgggcttt
tgttggttggtagggtattaattactgccccaatttcagaacttgttattggtctattca

Exon  2 +      18805      18891   0    Initial     87    55    Marginal
tgccttattccaggattaagattttggattttattctaaaggtgaggggaagacatttaa
tagttgtaggtggtaaagaaacataacaacatagaatctgacaagggagaaagtgaggca
aacaattaggaggttagcattgaaactatgagttgatggtggcttgaacaacgggtagga
ATGGAGATAGATAGTAGCAATGGGGACATAGAGTGTAAGCATGCAAGAAATACTGCAGAG
GAGTACTCACATGATGTACCTGATTGG
gtgactgattgaatgttgggaattaagatatttaaatctttattatgtggacaatgtttt
aatttctttcttcctctattaacataaaaattaagcatacactttttttttttttttgag
acagagtctcactctgttgcccaggctggagtacagtggtgccatctcaggtcactgcaa

Exon  3 +      22710      22868   0   Terminal    159    64    Marginal
tgtcattattttaaaagattattcctcaaataaatgtcaactcaatttctaacctttgta
aaacatactgtatgtgaattcttaaaaaatcatcattataggaaaaggaaaatgtttgat
gccattttagcattgattacaaaataattctaccagcatttatgcatatttcacatacag
GGGAATTATGCAGCCACTTCTCTTCAAGACTACAACATCATGGAAGTGGAAAGAGAAAAA
TACGCATTTAAGAAATGTGTATATCTAGCTATTTCCTTATTCAAAGTTTTTAGCACCTCC
ATATTTCAAAATGCCTATGCATTCAGCTTTAGACTCTGA
gtatattactaaattccactatttcaatcagaaatcttcaaatcagcttatttaatttgc
tcaagcagtgctgaataaactggacttcatcaaaattaagaatttctgctttgcaataga
tattgtcaagagagtaaaaagacaagccacagacaaggagaaaattttttgcaaaagaca

Exon  4 +      27360      27436   1   Terminal     77    87        Good
tttcatctttgacctaacaggatagtgaattactttagtatatttgcagtttgtgaacca
atcttacgcttggtcatggtgtaatatttaagtatatattggttcctttggtagcatttt
tatttaaaatcaatgattgagattcattttatactcacctttttctgttatttttgctag
GTTTTGGTATCAAGGTTATGCTGGTTCCTAAAAAGAACTGGGCAGAGTTCCTCTTCCTCC
GCTCTGATGTAGTTTAA
atagcctaagaactctgctctttgaagatctgaaagaattcactcatgaaaccatgtggg
tctgggagttcattgttcttaagacagcaacaatactcagcaaaatggttcagaacaaac
aaaaactccttggagtaaatacaattgaatgaaagagtctgggacacggtaatgtcaaga

Exon  5 +      27756      27862   1   Internal    107    95   Excellent
tacaattgaatgaaagagtctgggacacggtaatgtcaagaactaagaacagctgctgta
ctgatgctggttatttcccccctacacacaacttttttttcatggacaaggaaaaatgct
gtaggtaggctgaggctgttaagtaaaatgtcttgctattctttctcttctcttcttcag
TTATGTTACAGAAGCAAGGGTATTGCTTCTACATGGGCAAATTTGTCTATGCCCTGAAAG
AAACCAAGAGTGAAACTCAACTGGGAAAGCATCAGTTTCACTTTATT
gtcactagcttcccaattttgccgggaaatttcttaatttaaaggtaataaccaagctga
cattttactgtagccaaatcctacagagggtttcaaaatgagtgggtgaaaaaatataca
agcttaacatgcttatacttatttaacatgaagtgaaaatcattagcatagttcaggtat

Exon  6 +      43860      44011   2   Internal    152   100   Excellent
aaattgtggaacttaaggtttcatacaatttctagtcaggattttagatgagacttatgt
ttatagtacttggtggtataatgtttgtggtaaaccttatagaactatctttaagatgca
tttttaaaatgaggtttatgtaacttagtaattatctaaattgatctcattattttgcag
ACCTGTCATTTACTCCATCCTTTATAGTGATGCTACAGGACGAAGAGGAATGGATAAAAA
CATTGGCGAGCAACTCAATAAAGCGTATGAAGCCTTCCGGCAGGCATGCATGGATAGAGA
TTCTGCAGTAAAAGAATTACAGCAAAAGGTGT
gtggttctggttttgaaagttattctttatcttggtacatggaattttagagccttttgc
atctgaaaaatgttatattgttagaaattgccctgaagaactataattacagaaatgcag
gtatatattaatggattaaatttgaagtttttgtttgttgttttttttaaaaatattgca

Exon  7 +      53182      53292   0   Terminal    111    48    Marginal
gtttgaatgtttgtcgcctccaaaactcatgttgaaatttaattgccagtataacaatat
taagaagtgggacctttaagagatgattaggccatgaggtctctgccccccatgggcata
attaatgctgctccaaaactgtcagtttggctgctgctgccctttctctttgctcttcag
TCACATGATACCTTCCACTATATGGAAGATGCTAGTGTCTTGGTTTTGGACTTGCCAGAT
ACTGGTGTCTTAGTTTTGGATTTCCCAGCATCCAGAACTGTGAAGAAATAA
atttctgttctttataatttatccaacctcaggtattctgctatagcagcacaaaacaga
ctaagacaatattgatgcaaaaaatcctcaacaaaacactagcaaatcaaatccaacagc
atattaaaagaattacatatcatgacaaagtgagacttattcctataatgcagtaatggt

Exon  8 +      54100      54210   0     Single    111    53    Marginal
tagaactaataaacaaattcagtaaagttacaaaatcagcatgcaaaaatcagttgtgtt
tctatacattaacaacaaaccatttaaagaagacacaaatatatggaaagaaatcacatt
ttcattaattggacccttgcctttctccatatacaaaaattaaaacagatcaaagaccaa
ATGCAAGAGGTAAAAACCATGAAAGACTTAGAAGAAATCTTAGGGGGAAAGGTTTATGAC
ATTGGATTTGGCAGTGACTTTTTGCGTATGACACTGAAAACAGGCAACTAA
ggaaaaaatagttaagttggacttcgtcaaaattaaaacttttgtgcgtcaaagggcact
atcaacagagtgaaaaggcaacccacagaataaaagaaaatatttgcaagtcatatttgg
taagaaattgatatctagaatatataaagaactacagctcaacaacaacaaaacctggat

Exon  9 +      61810      61913   1   Terminal    104    89        Good
acacctgaatcctaggttacaacgaactagaaaaatgactgagagatctggcttcggtga
taaccagagcttttgttcataaacatgtgctacatgctctgtgtcttagtccatttgcac
tctataacaaaataccttatacaaggtaatttgtaaataatagaaatttatttctcacag
TTTTAGAGGCTGAGAAGTCCAAGATCGAGGCTCCAGCAGGCTTGGTGTCTGGTGAGGGCC
CAGTCTCTGTTTCCAAGATGGCACCTCATTGCTGCATCATCTAG
tggagatgaacactgtgttctcatatggcagaaaggatggagggcaaaaaggactgaact
ctgtgtgaagccccttttataaaggccttaatcttattcatgtgggagcagcccttataa
cttaatacctcctaaaaggccccacttcttaataccatcacaatggggattaagtttcaa

Exon 10 +      67682      67841   0    Initial    160    69    Marginal
gtctttaaataagttaatctttaaaacttctgcggtgctttaagtgtcttgaatcactga
tgtttgtaacaattacaagtacattcctggagccagtttgtatctcataaatcacaatac
ctgcaaaatgacaatgtgggcaactcatatctatttatattatcaatggatggtaaatat
ATGTTCATGTCTATCAGTGAATATCAGGCTAACTGGTTTTTATGTCAGCAGACTGAGAAC
TATGAGCAGAGAATACGTGAACAACAGGAACAGCTGTCACTTCAACAGACTATTATTGAC
AAGCTAAAATCTCAGTTACTTCTTGTGAATTCCACTCAAG
gtatgttcatgttaattttttatgtatttctagaacctcttggtgaaaagaaaggtgtaa
gttgagtttttctattttattccttcgttgtttctcaatagttttgatattataactgtg
gtacagttatatgttatgtttatttaaatgaacacttgcaggatatgggaaagtggactt

Exon 11 +      68921      69072   1   Terminal    152    71        Good
ggaaggaaaaaatataaatggacaacttgtcaaagtaactattacctaaagaattttcta
aaactcctaccttaaaatgtattctctttatggttttgagtttgtattattttttgcttt
ttcaggtggtaccaaaaataagggttttctgctaatgtccaagaggtttttgtcttgcag
ATAACAATTATGGCTGTGTTCCTCTGCTTGAAGACAGTGAAACAAGAAAGAATAATTTGA
CTCTTGATCAGCCACAAGATAAAGTGATTTCAGGAATAGCAAGAGAAAAACTACCAAAGG
TAGACATTGCTTCTGCAGAAAGCAGCATTTAA
atgctgatgcgtgacatagcttcctcattttatttttctgaagtgatctgctggaattcc
aaacagaagttccatatatacaaatatgtggcttaaatatttctaaatagaagaactatt
ttcaagtaaaataaaggctgaggttttgtatttcctactgaccgtttttctacatcacaa

Exon 12 +      84150      84253   2   Internal    104    72        Good
ctgtatccagtgcttgacttcactataacatcttttgtctcagtatatgtagactggtaa
ggaaatattcaacctcagttcctcctttaacatttcattcttagttctcaaaaatctaag
tgacaaatgaatctttattttcagtttttttcctactacttacttttcctttttctgtag
TGAATTTTATCAAGCTAACATTTATACCTATTCCATAGTTTATATTCCCTCTACCAATCC
ATCCCATCCCACCTTGGCTTACTTCTTGGTTTACATTGATCCAA
gtaaggattctcgtttctgttttaaaagcatatttctatttagcctcatcccgaaacgaa
ataaaacattgactacactcagttgcctaagctagctaaaaataaatattcctttgcatg
caaggatcgtaactaaagtttaaagggagtctttgatatgaacactggagttaagtgaaa

Exon 13 +      88877      88992   2   Internal    116    78        Good
tgcctggccctctacaaacacaagctgattttggggacattgtttaggaatttaaaataa
tttttttttacttttaaataattattttgtggcacataaaatggtactacataagtttga
ttatttaaaaaacttggaagttatagctttacattttaaaatgttgatttttttttttag
GGGTAATATAGAGAAGACTTTCTGGGATCTGAAAGAAGAATTTCATAAAATATGCATGCT
AGCAAAAGCACAGAAAGACCACTTAAGCAAACTTAATATACCAGACACTGCAACTG
gtaagatttaatttaatttacagtaatattgatttgcttgattgaaattgatttcctttt
gaatgtgaaaatattcctgaatgcctattaagtgtgtagcatctgtaatttacccctcat
ccacgtatgtttgaatgtgtacatgctgtgtaagttctgtaatgtattacatgtgtaatt

Exon 14 +      94487      94525   0   Terminal     39    47    Marginal
atgtctgcctttagcaactcatactcccttttaatttgctgtttcaaaccagctatgagc
tgtggaaataccaccaagtttgttagaataaatctaaaatgacaataggaacaaaattca
tctatctatgaaccttgtggctctaattctggctcctcagaagctctgttttctttctag
CTTTTGACTGTGTCCTACAAAGCTGAATTTGTTGGATAA
gtggttctagataaatgagctacagaggcccttttgtctaccagatatttacctgttttt
tacagaggtcttttttaaaaaaagatataagatgataaaataatctattcatccacagtt
ttcttaacatgcatcacaatatttcatccttcctttgccttcactgtcttctttttccca

Exon 15 +      95217      95797   1   Internal    581    68    Marginal
cacccgctggagactgctaatattctgtgtaagatggtagcaaattttaaaatcccagtt
gtcttcatttgctataaaaaccaatagaaaaaataataataatctctccaaagctgattg
aacagatttttttaatgatttgaatgcggctgtttctcttttgtgttcttctccctccag
AAACACAGTGCTCTGTGCCTATACAGTGTACGGATAAAACAGATAAACAAGAAGCGCTGT
TTAAGCCTCAGGCTAAAGATGATATAAATAGAGGTGCACCATCCATCACATCTGTCACAC
CAAGAGGACTGTGCAGAGATGAGGAAGACACCTCTTTTGAATCACTTTCTAAATTCAATG
TCAAGTTTCCACCTATGGACAATGACTCAACTTTCTTACATAGCACTCCAGAGAGACCCG
GCATCCTTAGTCCTGCCACGTCTGAGGCAGTGTGCCAAGAGAAATTTAATATGGAGTTCA
GAGACAACCCAGGGAACTTTGTTAAAACAGAAGAAACTTTATTTGAAATTCAGGGAATTG
ACCCCATAGCTTCAGCTATACAAAACCTTAAAACAACTGACAAAACAAAGCCCTCAAATC
TCGTAAACACTTGTATCAGGACAACTCTGGATAGAGCTGCGTGTTTGCCACCTGGAGACC
ATAATGCATTATATGTAAATAGCTTCCCACTTCTGGACCCATCTGATGCACCTTTTCCCT
CACTCGATTCCCCGGGAAAAGCAATCCGAGGACCACAGCAG
gtaactgttttgcattaacaaatatattattatgtgtgaacacacattttgccatacatg
cacagatatgcatctcttttacgttatcaaacatcctttttaaactactgacagccaaag
ttaaggctttcaaaaaaacaagtcccataataaatgacatgaaattagaaaagctgaata

Exon 16 +      99588      99764   0   Terminal    177    60    Marginal
ccctttatgaaaccacgaattgagtcatgtcatgctaactttacggaaaagtaatttgct
tttatattagggaattcaatatatatgcccatgcgtaactcattcagaaattcaaatttg
aagtccagtgctatttgaatttaaacataagtaacagatatttttgtttgtttcctgcag
CCCATTTGGAAGCCCTTTCCTAATCAAGACAGTGACTCGGTGGTACTAAGTGGCACAGAC
TCAGAACTGCATATACCTCGAGTATGTGAATTCTGTCAAGCAGTTTTCCCACCATCCATT
ACATCCAGGGGGGATTTCCTTCGGCATCTTAATTCACACTTCAATGGAGAGACTTAA
gacacatttgaaaacagacatatcaagttctatgtgatgattttgggtttttaatactat
aaatacttgattgtaaactaaattcaagatcatttataggaaaatctagtttcacagcta
tttgaatttttttctggatttactatataactcttattttttaaaagatcattctgttct

--------------------------------------------------------------------------------