--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (10906 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1914       2029   2   Internal    116    77        Good
tccgccacccccgcggcgcctgccttccctgggagcagctgccgctcggtcgggccggag
ccctcgcccggtgcgccaaggtccgcattgccccgggcccagggcgggagcgcctcgctg
cccaggcttcagagctccctctgtaggccccgggggctcccctccgcgcgccccctccag
CCGCGGCCAGCTGTGGGCGCCGGGGCCCGAGGATGGGCCGGGCTCCGCGCGGGTCTTGCG
GGCCCCTGGGGGGCGGGCGGCCGCCGGGAAGCGAGGGGGCGGCGAGGAAGGAGCAG
gtgcggtctgggcagcgggggtattcccggctccgcacagacggggccgggggcggcgag
gtgtgaaatgaggcgcgcggagcggccgggacagcgggccgggggtggcaggagaaccgc
caacgcgccccgccggcccccgcgcctgccgccaccgtccacctgcccctctgagcggcc

Exon  2 +       5398       5527   0    Initial    130    51    Marginal
agctcccagatacgaccaggcctggggaaggagatggtctgatgaggccagcactgggga
ctaaggacgtggagtgagcaggccagcctgtgggccaggcccaggttgaaccatgttgct
tgcctcagtctcttcacagagccctcagagcccctccctgaggagtccaaacctgtggag
ATGCCCTTCCACCACTGCCACAGGGACCCCCTTCCGCCGCCGGGCCTTACCCCTGAGAGG
CTGCATGCACGGAGGCAGCTATATGCTGCCTGTGCCGTTTGCTTTGTCTTCATGGCTGGG
GAGGTGGTCG
gtaagttggggagcagcccttaaaccccattctccaaatacctgcccaagccactctcca
cccagagtcccaggaatgttcctgggtgcagatgcagagatggggatggctgggataggg
gagctgggtgcccaggactcaggaagtaggagggataagggacagcaacaaagggaattc

Exon  3 +       5973       6201   1   Internal    229   100   Excellent
ataaaatacagatgaatgaaaaaaataacataacagtagttaattatacctgtagtccca
tcacctgagaaaaccccaaatcacatttttggtgtatatcccccaatttattttccatgc
ctatacacactacatgatattttctaaatggaagcagactccatcatttcaccctggcag
GCGGGTATCTGGCACACAGCCTGGCCATCATGACCGATGCAGCCCACTTGCTGGCGGATG
TGGGCAGCATGATGGGCAGCCTCTTCTCCCTCTGGCTCTCCACCCGTCCAGCCACCCGCA
CCATGACCTTTGGCTGGCACCGTTCAGGTAAGGCCCCTGCATGGCCCAGTGACTCTCCAA
TCTTGCCAGAGGGCACCCGTCAGGGTCCCAAGCAGGTCTCTGACAGCTT
gtctccccccccacccgcagagactctgggggctttggcctctgtggtctccctctggat
ggtcactggcatcctcctgtacctggccttcgtccgcctgctgcacagcgactaccacat
cgaggggggtgccatgctgctgaccgccagcatcgcagtctgtgccaacctgttgtacgt

Exon  4 +       6222       6375   1   Internal    154    87        Good
tgatgggcagcctcttctccctctggctctccacccgtccagccacccgcaccatgacct
ttggctggcaccgttcaggtaaggcccctgcatggcccagtgactctccaatcttgccag
agggcacccgtcagggtcccaagcaggtctctgacagcttgtctccccccccacccgcag
AGACTCTGGGGGCTTTGGCCTCTGTGGTCTCCCTCTGGATGGTCACTGGCATCCTCCTGT
ACCTGGCCTTCGTCCGCCTGCTGCACAGCGACTACCACATCGAGGGGGGTGCCATGCTGC
TGACCGCCAGCATCGCAGTCTGTGCCAACCTGTT
gtacgtcccagtatggagcaggcaccttgtggggcccagggcgaggggtcttcctccagg
atgggagagctggctctctcctccccaccagacacacagacacgcacacacagctctcca
tgggctgccctgcgtgtgcctgagaagggtctgggatagagacctaaaattcagtcagca

Exon  5 +       6928       7126   2   Internal    199    77        Good
ccacatgtgtggcaccaagtctggtattctttcccccaggctgcattgtttatctctctt
gcaaaatgctgttttcttccaggggctgggaaagggctactggggaggtgagacatggag
atgggggtataggaggccaggagcagggccctaggctgaggtgctctgcttacccctcag
AATGGCCTTTGTGCTGCACCAGGCTGGGCCCCCCCACAGCCACGGGTCTAGGGGAGCAGA
GTATGCACCGCTGGAGGAGGGGCCTGAAGAGCCCCTGCCCCTGGGGAACACCAGCGTCCG
GGCGGCATTTGTGCACGTGCTGGGGGACCTCCTGCAGAGCTTTGGGGTACTGGCTGCCTC
CATCCTCATCTACTTCAAG
gtaccatcattggagacctgccccagccttcctccccacaaccacatcccagcccactcc
ttcccaggtcccaaagcttccttcctcctccctccagctcctccctcccacctcccagga
ctctcccagacatgagtcatgttccctgtcccctcttcagggttttgaggggcctctcag

Exon  6 +       7387       7492   0   Internal    106   100   Excellent
cttcctcctccctccagctcctccctcccacctcccaggactctcccagacatgagtcat
gttccctgtcccctcttcagggttttgaggggcctctcaggtcatgtttgttcaagatac
ccctagatcttcctctgaaaggtccctggttgttgggcttaggggtctctttctctgcag
CCTCAATACAAGGCAGCCGACCCCATCAGCACCTTCCTCTTCTCCATCTGTGCCCTTGGA
TCCACCGCTCCCACCCTCCGAGACGTTCTTCGAATCCTCATGGAAG
gtgagtcgggcaccacagctccccatccctgtggccctctctgactttactctcgcagtg
ggccatcacttttttctttgaagatagtacgggaagaaggcttggctcatggggtctgct
gctggaacaaggatttgggcatagggtgaattgtaggggtcaaaaggagagtgcatacag

Exon  7 +       8820       8968   1   Terminal    149    84        Good
gtgagtctctccaacatttgatttgacacttttatgctgttcatacaatacagaaagaaa
agcaggcttccattcacgcctggctttaatgctgtgcagcccctttccctgtccttatct
cagtccctgcctgttctttctcccccgggatggatgccgcctcttatcactctcccacag
ACTCCACCGCTGACCCTGAAGCCGTCCTGGCTGAAGCCTCATCCCGGCTCTACTCCCGGT
TTGGATTCTCCAGCTGCACCCTGCAGGTCGAGCAGTATCAGCCGGAGATGGCCCAGTGCC
TGCGCTGCCAGGAACCCCCCCAAGCCTGA
gccatggccctgccctcaccccactgccaggccgaggctcagccccagactctcagcatc
tgctgccctgatcacagagacgggaccgagccaggtccataccccttcctctctccctcc
taccacctgccagtttccccagcctcagccccagccccagccccagtgggcaagaccaaa

--------------------------------------------------------------------------------