--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (40586 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +         94        326   1   Terminal    233    48    Marginal
aagtatggctgctgggattggccaagactgagctattgttacagatgcatactcctaagt
taagttctcaatcttgtctacatattaagttagGTGGCAGTTCATCTACAAGGACTCAAATATTGAAGTATGGAGTTCTTCTCAGGTCACATT
TAGCCTGTTTTAACAATGTAAAACCTAAAGCTGTAAAAACTCTGGAAGATAAGCTAGGAA
ATTCCATTGTGGACATAATCGCTGGCAAAGATTTTATGATAAAGATGCCAAAAGCAATTA
CAACAAAAACAAAAATTGACAAATGGGACCTACTTAAACTAAAGAGCTTCTGA
acagcaaaagaaactatcaacagagaaaacaacctacagaatagaagaaaatatttgtaa
gctctacatccaacaaaggcctaatattcagaatctataagaaatttaaacaaattaaca
agcaaaaaaacaactccgttaaagtataataataataataagtggttaaaggacgtggac

Exon  2 +       4427       4537   1   Internal    111    99   Excellent
aaccttctgggaatgcagcccagtaggtctcagccttatttcacccagctcctattcaaa
atggagtccctctggtttgaacacctctgacaattgtatatgagaagaatgaaataataa
taaatttctcacttctatttagcagaatttttcattaaaatatcttttgttatgtttcag
TGAATAACCCTATACCTTCCAATTTGAAATCAGAAGCAAAAAAGGCTGCCAAAATATTAA
GAGAATTCACAGAAATAACTTCCAGAAATGGACCTGATAAGATCATTCCTG
gtaggtaaataggatgagtgctgtttgtctctaaatgtctttttcctaagttgttttttg
cattgttcgacactccatttcaggcagaagcctccatcaatgccaacaagtagttcagcc
accttttgttccaccaccttttttctcatgactgatccagggatgctttggaaactacta

Exon  3 +       6494       6774   1   Terminal    281    52    Marginal
aattaaatctataattggtacattctatgttataaatcaaaagctaattggcagattatt
cagggattattaatatgttagtgtccctgaatttgagtggaaatctgtaaaaatataatt
gacatgtggaatatgtccattttaaaatgtgcttttgttaatatctaatattcccaatag
GGGCAATAGCAACTCTAGAAGCATCGAGAACAGAATGTGAGGAAGACATTCTGCCAACAG
GTGGCTGTAAAAATAAATCTGCACAACATATAATACAGCTTTCAATCTTGTTACAATATA
ATTATAACCTTTTAAAATACAAAAATAAAGTACACTTAGTAGACAGCCATCCAGGATGCA
ACCTTATTTTCTGTAGCTTTCTTATTAAGAACAGCTCCACAAATGTTCTGCATGCAAACT
TCATGGTGTTGGATGAATTATTTCCAAGAGTCGGTTCTTAA
tttaaactttgaaatggtggcataattacatgagaattttagtgttctcttgggtcatct
gcaaagcttttgctctgtgtactagagccccatgtctgacttcacttccttggcagaata
tttgataaaaataataataagttaaactaccttaaagttatatgttaggcttccctcgtt

Exon  4 +       7698       7811   1   Internal    114    80        Good
tcatgggaatagagaggcctcgtgcccatctgttgagtgactgacttttgttcattgctc
ctgtgtgccccgaattcctagagataacctctgtgtacactgactctgtttaacacttgc
tcgtctatccaggcacatagatcaaaatgcttaccttcccattgttttccacgttaacag
CTCACGTAATTGCGAAGGCTAAAGGCCTTGCAATTCTGTCTGTGATCAAAGCCGGGTTCC
TGGTGACTGCCAGAGGAGGCAGCGGGATTGTAGTGGCGCGCCTTCCAGATGGAA
gtaagttggcgtctgttcactggagtagagagtcttcattctttgttctgtctgttttca
tgtgaacacattgcatagcgagtaggacaggtttcctgcatatcaactaaaacttatgta
ataagggctactcgactgaacgtgcagtttggtgtcagtgaacaagccacaggaaccagc

Exon  5 +       9940      10004   1   Internal     65    87        Good
atatttttaactttttaaaaattacatattctttttgaagatcactttaaaatcagggga
aataccaagtctcattattttcaatagaagcactctttagattttagcatttttccttcc
tatatttacatgtcgagggtgttttaatgttaggataacgttcgtttgtttttttattag
AATGGTCTGCACCCTCAGCCATTGGGATAGCTGGCCTTGGTGGAGGATTTGAAATAGGAA
TTGAG
gtaagtagcttgtgcacgtccatacaactgccatatcctctgaagacacctaagatgcaa
cctgtgaaaactgagaggtttcctagcgttcttattgttaccattggcacttaggaaaaa
ttgtttcctttattttctcgatgaatgtctaactaaagctatctgatggttcccatttac

Exon  6 +      23270      23382   0   Internal    113   100   Excellent
caatattggcttcataattcatcagctcaaaataaaaatatggctcttgtctcacgttct
ttcctgtctctattgatgttttgctacagtgcatatggtgtagttgagtgttagtcaaga
tgaattttaaatgatatttagtcttaacgatttttaaatccatgggtttctacactttag
GTATCAGACTTGGTGATAATTCTGAATTATGACCGTGCTGTAGAAGCTTTTGCAAAAGGC
GGAAATCTGACCCTCGGAGGGAACTTGACTGTGGCGGTTGGGCCCTTGGGAAG
gtgagttctttaaatagatgttagacagtaaaggtttaacaactgcatattttattttgc
attaataggaaacttgaattaaaatgaacagatttgtacatccccagatttatacatgcc
cgaaagatttgaggtcatcacaaataggaaattcacaaaacacagccagtgagataagct

Exon  7 +      24313      24457   2   Internal    145    62    Marginal
tttttcctctaggccacattaaaacatctaatttaggcctacagtaagtaaaacatagaa
acagctgaagaaggtacagaacaaaataattcatttgagctagaaggagtgctatttaaa
tagtgatcctcggcttggagctgctcacagctttgtgatgcaaaatcttgtgctttgcag
GAACTTGGAAGGAAACGTGGCCCTGAGAAGCTCCGCTGCCGTCTTCACGTACTGCAAGTC
AAGGGGACTCTTTGCAGGCGTGTCTTTAGAAGGGAGCTGTTTGATTGAAAGGAAAGAAAC
TAATAGAAAGTCAGTTCAAGTTAAA
gtgattttaattgaaagtgtgatgagaaaatagtacttcaaaagttgatataatttgcag
agtacatttatatattctttttacaacatgtggttttaagtgtgtatcttacatttaaaa
attaaatatacaaataatatatgctcgtagaaaatgcagaagacacatgaaaaagaaata

Exon  8 +      25458      25661   0   Terminal    204    50    Marginal
tacagtttgatttaaaaaaaaaaaaagaatctggaagtatcctaaaaggtaaagggaaac
ttctactttaaattggcatctggctgatttttcccaaagatgcaaattaagtggctctta
caaattgccactaaaatatgtgtaaaggcccagaaagagataaagagctaagactgacag
CAGGACTTCTTCCAGAACCTGCAGAAGTTCCATCATTGCCAGCTTGATCGGCTGGCACTG
CTGGCATTGGCCATTCAAATTCGCCACGCGTGGCAGACAGACCCGCCACTATCCGAGACA
AAGCATCCAGTGTTTACCCCACCGAGTCATTCAGGAACTGAACAGCACTATTTAATAAAG
CTAAATATAAACCACAAGAGGTAG
aaaataggagggatggggaaaaataaggttttcagaactattcatcttataaaatcaaaa
gtgatgtgttaactcctggctttattaatttgagaacagttaacaaaagaatgcttttag
aaacttctggttcgagcccgttggcaggccttcccactaaagttcaactaaaccctggat

Exon  9 +      26351      26573   2   Terminal    223    87        Good
ggggtacatttaagacttgaacatgggatattgcttaaagttagtgtttaaaaagtagtg
tatatgaagtgctatgtatgaatgattatatatacacaccgtgtgtgcgcacatgctatg
tttaactctagaaaagatttgtgtatattaaaatgtttttaattttatatttcccattag
ATTTTATTGTCAAGATATCCGAGCTTATGACATTTTATTTGGAGATACACCGCGGCCTGC
TCAAGCCGAAGATCTTTATGAAATTCTTGATTCCTTTACTGAAAAGTATGAAAATGAAGG
ACAACGAATCAATGCAAGAAAAGCAGCAAGGGAGCAGAGGAAGTCTTCTGTACCGTTTGG
TTTTATGTTTCACTCAGTATTCTCAGAAAATCTCTTTCTGTAG
aacattctgtccctgatatcaggttcctaagaacctactaagcctccttcgtagtttcac
tgacttcacattcttgtgaaaaggtcatgctaccttgacatttcctctgtacagatttca
gggaaaaacataatttgtcctctgtgattgcatttctccaaggatggaactttgttgtat

Exon 10 +      32105      32259   0    Initial    155    55    Marginal
accaaactttatttctaaattctgactttcataaatgtcttaggccagtggccttcacac
tggtgtgtgcctgtctttaggagtacgcagagactgcaaaagggggtgtgggcacaggcc
acttaagagacaccatctccagatctccagctcctggataagttctttttaaagctgaac
ATGATGTGCAAGGTGTGCTCTTCGTCTTCTGTACTGTTAGAATCAGTTTTTCTGCAGTTG
AAGAAGAAAAGCAAACCCCCAGACCGTTCTGCCTCTTTCTACACTACATCACCCCAGAGC
GTCAGAACGGGAATCCAGTGTGAAATGTGGATGCA
gttagtgaatggctcttatgcagtgtaaatccttccatgaatcagtgatttctgtttctt
tgccttcaatgcaattgaagaagaacctaatagaattgtcatctgaatttataatgagaa
tagtgtgtgtacttctgtgtcatacagatgtcaggtatttatcatctaccttatacttca

Exon 11 +      35814      35899   0   Internal     86    88        Good
agtcatttggagtttttcaaagaaaaaaactaacagggcacagcactaactggcttgtgg
attgttatctgagaaagcagataggctcctggatctgctggcctcactcttgtgattttc
atgtggatggagtttctccaacaacagctcaactcctgactctcttgtactcctccccag
GAGGCAGAGGCATTTGTGGTCAATTGGGTGAGGAATTGGGCACAAGGAACAGTCAACACA
CATCTTAGCCTCAGTAAAGGAGAAAT
gtgagatcccggccccctcagaccttcagtggtggccttcccttcagctgcacctgaaaa
ccacccacgttgctcctctaccctcctctctcactctgctttatcctcatttcatttgga
atctgcaattcagagaaaattagaccaacacctgattgtgagggcagggaccaaaccagg

Exon 12 +      37744      37795   0    Initial     52    42    Marginal
gctcagttctcaaagtattttcttccttctgcaatacatggatatacacattgcattgaa
gtacttgtgaaacatgtagaaatgctcctacctgtgctaattccaacttatctctgatat
tgagaggatggatcaattaagcacagaaatgtaaacagccacaaagcccagggagaagaa
ATGTCTGCTGAGGAAACAGCAAAATATAACTGGGCTGCAATCTTCAAGCCCA
gtgagtaaagagccaggttttaaagttgaatctcctagggtttgatataagctcacatat
ctgcctttctccagcatctgccatccatgaaactgtcacactatcttggccccttccagc
tgctgtaacaaaacaccatagtctgggcagctcatagacaatggaattttatttctcacg

--------------------------------------------------------------------------------