--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (10287 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1392       1490   0    Initial     99    81        Good
atgggaagggtcggaggcatggcacagccaatgggaagggccggggcaccaaagccaatg
ggaagggccgggagcgcgcggcgcgggagatttaaaggctgctggagtgaggggtcgccc
gtgcaccctgtcccagccgtcctgtcctggctgctcgctctgcttcgctgcgcctccact
ATGCTCTCCCTCCGTGTCCCGCTCGCGCCCATCACGGACCCGCAGCAGCTGCAGCTCTCG
CCGCTGAAGGGGCTCAGCTTGGTCGACAAGGAGAACACG
gtgagcccgcggggagggcgctgcgggcaggggagggaggcagggaaagcgaagccgctc
ctcactcacacgcgtctccccgcagccgccggccctgagcgggacccgcgtcctggccag
caagaccgcgaggaggatcttccaggagcccacggagccggtgagtggcgggcgtggggc

Exon  2 +       1576       1650   0   Internal     75   100   Excellent
tctccctccgtgtcccgctcgcgcccatcacggacccgcagcagctgcagctctcgccgc
tgaaggggctcagcttggtcgacaaggagaacacggtgagcccgcggggagggcgctgcg
ggcaggggagggaggcagggaaagcgaagccgctcctcactcacacgcgtctccccgcag
CCGCCGGCCCTGAGCGGGACCCGCGTCCTGGCCAGCAAGACCGCGAGGAGGATCTTCCAG
GAGCCCACGGAGCCG
gtgagtggcgggcgtggggcagaggggccagggacggccttgggcgtcttggcgccaaag
ccgcattgtttcctcagctgttcacactcccgccccggctcctttcccgcctaggcggcc
cctccccagggctgcctcccgcgcccctcggcccatttcccggttcgggcgtgcgctcct

Exon  3 +       1980       2162   0   Internal    183   100   Excellent
ggcccatttcccggttcgggcgtgcgctcctctgctgcgacccacggagtgcgacgggac
agccacgttttcacatcgggccccgtgaaattgccgccaatggaaaggacttggtccaga
aaaacgttagtttcatatggttcgcccggtacttaaatgttttattttctcccccaacag
AAAACTAAAGCAGCTGCCCCCGGCGTGGAGGATGAGCCGCTGCTGAGAGAAAACCCCCGC
CGCTTTGTCATCTTCCCCATCGAGTACCATGATATCTGGCAGATGTATAAGAAGGCAGAG
GCTTCCTTTTGGACCGCCGAGGAGGTAATCGGAGGACCCCAGAAGACCCCTGCAGGGGTG
ACC
gtcacgcctcagacataaatgcacttggaggttcccgttggcaaggggggctaactgtgg
ggcatagtaagtggtgccagcatacttaaagtttgagtgctcagtgtgagtcctgtaggc
tttactctcttccttttatgctaaaattgtgacttccgaacctcaggtggacctctccaa

Exon  4 +       2329       2445   0   Internal    117    72        Good
ctgcaggggtgaccgtcacgcctcagacataaatgcacttggaggttcccgttggcaagg
ggggctaactgtggggcatagtaagtggtgccagcatacttaaagtttgagtgctcagtg
tgagtcctgtaggctttactctcttccttttatgctaaaattgtgacttccgaacctcag
GTGGACCTCTCCAAGGACATTCAGCACTGGGAATCCCTGAAACCCGAGGAGAGATATTTT
ATATCCCATGTTCTGGCTTTCTTTGCAGCAAGCGATGGCATAGTAAATGAAAACTTG
gtgagtttccaaaacatctttcattcatttgacgttgacgatctgaggtcgaactagttc
gctttcctcgtcttgtatgtttttccatgctgagtgcatctgtgtgtgtaagctgggttt
tatattacatggcatttcctgttttgtaacactttgcagttctttcttatggtattttcc

Exon  5 +       3310       3443   0   Internal    134   100   Excellent
tttcctgatatgtaagttgagcatatgacataaaatatcaaagaattgtgacaaattgga
tgaaatatatatagaaataaaccttataatggtacaaagagtgcgatgctgccagtatcc
gttgacagttgctgctgttggttttttctcaagcttaactttgatgtgttttgccactag
GTGGAGCGATTTAGCCAAGAAGTTCAGATTACAGAAGCCCGCTGTTTCTATGGCTTCCAA
ATTGCCATGGAAAACATACATTCTGAAATGTATAGTCTTCTTATTGACACTTACATAAAA
GATCCCAAAGAAAG
gtgagtattcaagtggtatgccaagatttttaggactcactaattgttgatttattacac
atttttagttcacctagggataaaaatgactccagaatgactaagacagtcataggcatt
cccagcacccgtggtcatgtctgctcttagcaaggggcctaaatgcactttattattcac

Exon  6 +       5468       5562   2   Internal     95   100   Excellent
aacactggagggaaaaactgaccagtaaaaataaaacatttcggtgtgagttcttccttt
aggaagaggattggcaaatacttgaatttggcctttgtcccagagctcttatctagcagt
tggtaatcggaggtcttttactgtaatgcttcaattgctgataccgtatgtgcctactag
GGAATTTCTCTTCAATGCCATTGAAACGATGCCTTGTGTCAAGAAGAAGGCAGACTGGGC
CTTGCGCTGGATTGGGGACAAAGAGGCTACCTATG
gtaaggagacccttgcccctacttaaacctgagcttcattttccaagtaatgttactgga
tttttggcccttgaataccaactcactagaatcatgttggtgttaactcctaaataggtg
aacgtgttgtagcctttgctgcagtggaaggcattttcttttccggttcttttgcgtcga

Exon  7 +       7441       7545   0   Internal    105    80        Good
ggtagtgacatcagcagagaagtcagtagttgaagtcatcttccctttgagagttcaagt
gctctcagtatggctgagcatgttggataaggagaatgcagaaaaggacaaagtaatttc
atattccatgttaatgacagaagtcttctggctttagtgatcttgaacttttttttctag
GGTTTACACTGTGATTTTGCTTGCCTGATGTTCAAACACCTGGTACACAAACCATCGGAG
GAGAGAGTAAGAGAAATAATTATCAATGCTGTTCGGATAGAACAG
gtaaagtgggtgatgaaatgggtcactcaagcttgctagaaaatgcctgtgctttagttg
tattcagaagctgtattttggttcctaggagttcctcactgaggccttgcctgtgaagct
cattgggatgaattgcactctaatgaagcaatacattgagtttgtggcagacagacttat

Exon  8 +       7634       7747   0   Internal    114    83        Good
attttgcttgcctgatgttcaaacacctggtacacaaaccatcggaggagagagtaagag
aaataattatcaatgctgttcggatagaacaggtaaagtgggtgatgaaatgggtcactc
aagcttgctagaaaatgcctgtgctttagttgtattcagaagctgtattttggttcctag
GAGTTCCTCACTGAGGCCTTGCCTGTGAAGCTCATTGGGATGAATTGCACTCTAATGAAG
CAATACATTGAGTTTGTGGCAGACAGACTTATGCTGGAACTGGGTTTTAGCAAG
gtaaagtattgtttacatagccttttgcttgttttgaagctggtgctctgtatttatatc
ttgatgtgaaccttttcaggttttcagagtagagaacccatttgactttatggagaatat
ttcactggaaggaaagactaacttctttgagaagagagtaggcgagtatcagaggatggg

Exon  9 +       7827       7979   0   Terminal    153    68    Marginal
aggccttgcctgtgaagctcattgggatgaattgcactctaatgaagcaatacattgagt
ttgtggcagacagacttatgctggaactgggttttagcaaggtaaagtattgtttacata
gccttttgcttgttttgaagctggtgctctgtatttatatcttgatgtgaaccttttcag
GTTTTCAGAGTAGAGAACCCATTTGACTTTATGGAGAATATTTCACTGGAAGGAAAGACT
AACTTCTTTGAGAAGAGAGTAGGCGAGTATCAGAGGATGGGAGTGATGTCAAGTCCAACA
GAGAATTCTTTTACCTTGGATGCTGACTTCTAA
atgaactgaagatgtgcccttacttggctgattttttttttccatctcataagaaaaatc
agctgaagtgttaccaactagccacaccatgaattgtccgtaatgttcattaacagcatc
tttaaaactgtgtagctacctcacaaccagtcctgtctgtttatagtgctggtagtatca

Exon 10 +       8146       8227   2   Internal     82    53    Marginal
atgctgacttctaaatgaactgaagatgtgcccttacttggctgattttttttttccatc
tcataagaaaaatcagctgaagtgttaccaactagccacaccatgaattgtccgtaatgt
tcattaacagcatctttaaaactgtgtagctacctcacaaccagtcctgtctgtttatag
TGCTGGTAGTATCACCTTTTGCCAGAAGGCCTGGCTGGCTGTGACTTACCATAGCAGTGA
CAATGGCAGTCTTGGCTTTAAA
gtgaggggtgaccctttagtgagcttagcacagcgggattaaacagtcctttaaccagca
cagccagttaaaagatgcagcctcactgcttcaacgcagattttaatgtttacttaaata
taaacctggcactttacaaacaaataaacattgtttgtactcacaaggcgataatagctt

--------------------------------------------------------------------------------