--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (43570 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      11219      11361   1   Internal    143    95   Excellent
gggaaaaaaaggtgcctctcccagccaatctccaagataacatttcggtcttgttattta
atgttaggaggaaaaaaatctttgttttagtctgctgttataaaaaaaacagaatgttaa
aatccattattaattgctatattaatctcactgacctcctcctttttaaaaacttttcag
GTGCGTATAACCCGTATATAGAGATAATTGAACAACCCAGGCAGAGGGGAATGCGTTTTA
GATACAAATGTGAAGGGCGATCAGCAGGCAGCATTCCAGGGGAGCACAGCACAGACAACA
ACCGAACATACCCTTCTATCCAG
gtaatagacccttcttctgtgtctatctcactattagttgcttcatatactagctatagc
aattattttaaagggccagtttcttcacagtcatctccacaggtttatctttttcttttt
tcctttttttttttaaacggatctgtcaaaaagacatctattagatagatgtctaaggac

Exon  2 +      13933      14081   0   Internal    149    95   Excellent
aagtttttctgtactggtattctctggaaagtttcatctaaactgcagttgttcgtcagc
tggattttatttatctagtgccaattacattataattaatgtaaattgaattctcattta
gtagatcagtttataatgcagtctatttggatcatgtatttaatttcccccttttttcag
ATTATGAACTATTATGGAAAAGGAAAAGTGAGAATTACATTAGTAACAAAGAATGACCCA
TATAAACCTCATCCTCATGATTTAGTTGGAAAAGACTGCAGAGACGGCTACTATGAAGCA
GAATTTGGACAAGAACGCAGACCTTTGTT
gtaagtacacagttacagacatcttcagaaataagataagacataggatgttctgtttct
tctccatgacaatctgttactttttagcagaataattttctcattctacttctatttact
gtattttacacttacatttttactatttgcattagaactaccctttcattctttattagt

Exon  3 +      19052      19161   0   Internal    110    99   Excellent
ttagccaggtagggtgtcatgtacctgtagtccagctactcaggaggctgaggtgggagg
atcacccgagcctgggaggcagaggttgcagtgagccggtatggtgccactgcattccag
cctgggtggcagagtgagatcatctcaaaaaaaaatgttttttaagatttatttttgtag
TTATTGGAGGCAGAGGAAGGAAATGTGAAAGATATTTTAGATGCTAGCAAAATTGTAGAT
GTGAAGAACATGAGCATAAGACAGCATGAGTATGGAGACAGGCAGACAAA
gtagcctccggttgcaagtgccatgtgaagtttgaacaatagtaatgttattataattga
gttttgcttccttattcacgcccacccaattttactgatgtcatggtttttccatgtggg
aacaagtatgactggtggtggtgggggagttccccccaccatcgtctatgctacacatat

Exon  4 +      20528      20619   2   Internal     92   100   Excellent
gcgcccagccatataatcccacttcttactctctcatctttatcagagcaattggaagca
cgttcatgctttggtatgtacaactgacagcatgataacttcagtattgctatatgtttg
atttttgcaatattccttgtgtttataatgcagttttgaatattgtttttttcctgctag
TTTCCAAAATTTGGGTATTCGATGTGTGAAGAAAAAAGAAGTAAAAGAAGCTATTATTAC
AAGAATAAAGGCAGGAATCAATCCATTCAATG
gtaagtatgtttgataaaatcatttctatttatttgggtgttgatttctgtttctttttt
ctttctctttttttttttttttttttttttgagacggagttttgctcttgtcgccaggct
ggagtgcaatggcgcgatctcagctcactgcaacctccgcctcccaggttcaagcaattc

Exon  5 +      30567      30686   1   Internal    120    86        Good
gaaccctggaggcagaggctgcagtgagccaagatcacaacactgcactctaacctgggc
gacagagtgagactctgtctcaaacaaaacaaacaaaactgagtatcaattttgacatta
cagaataaaacactgcattttgtattatagaatgatatgtatctattaaaatgcctacag
CAAGCATTATCCTAAATAAGAGAAATATCAGAAACATTCGCTTTGAAGTTAAGAATGAGA
AACCAAGGCACACTTTTACCACTTGTATTCAACATCGTAGTGAAGGTCATAGCCAGAGCA

gtgagcattgtagccagtgtacagtaagaccccccaaaaagtagaggcataggattgaaa
aatgaggaaataaaactataattatttgaaattattatagtgataacccaaaagatatat
aaatggattatttagataagtttaaaagagtgagctttgtgcattggcagtatagccaag

Exon  6 +      36413      36553   1   Internal    141   100   Excellent
tagtgattacttgataagaatgataaaaggcattcttgagattgtatactgttctatttt
tattcatacatatttggatgctattcaaggttattggctataatgggcagggaggaggac
ctagcaagtctttaggtctatgtgactattacatttaaaaaattttttttttctattcag
TCCCTGAAAAACAGCTGAATGATATTGAAGATTGTGACCTCAATGTGGTGAGACTGTGTT
TTCAAGTTTTTCTCCCTGATGAACATGGTAATTTGACGACTGCTCTTCCTCCTGTTGTCT
CGAACCCAATTTATGACAACC
gtaagtacttcattttcttatatttgtagtcttaacttgttttttgtaatagtttaattc
ttaaaattattttggtaattaggaaaacaatatattcatgataggaaaacttccagacat
tagagaaatatataacagaaaggaaatcttctctaatctcatcctccagagataatcact

Exon  7 +      37930      38142   1   Internal    213    95   Excellent
aggatttgtcgtgtaaacaagaattgtggaagtgtcagaggaggagatgaaatatttcta
ctttgtgacaaagttcagaaaggtatttatttatttcattgaatttagaataaattttag
attaatagatgcagttactttgttttcccatttttttttttttggtttcttattgactag
ATGACATAGAAGTTCGTTTTGTGTTGAACGATTGGGAAGCAAAAGGCATCTTTTCACAAG
CTGATGTACACCGTCAAGTAGCCATTGTTTTCAAAACTCCACCATATTGCAAAGCTATCA
CAGAACCCGTAACAGTAAAAATGCAGTTGCGGAGACCTTCTGACCAGGAAGTTAGTGAAT
CTATGGATTTTAGATATCTGCCAGATGAAAAAG
gtatgacattttgctggtaataatttatatatttcttgaagtggtcctgctaataacatc
ttcttgtaatattcatttgagtacagttatgtatattcataatttatgtttcttttcctg
gaagctttctgttggttttttctttatgctctttgcatctctttatttgttgggttgttt

Exon  8 +      38796      38893   0   Internal     98    87        Good
taaaatttctattttatttttgaaggtctgttttagtctttgtgcacttaccactcagag
agtagtctctatattggtttcttatcaaaccttattgcattagttgacattattgacttg
tgtgataagaaaacaagatgaatattttaaacagcttgttttgggttttttttgagacag
GGTCTCACTCTGTCACTCAAGCTGGAGTACAGTGGCATGATCGTGGCTCACCAGAGCCTC
AGCCTCCTGGGCTCAGGTGATCATCCCACCTCAGCCTC
gtgagtacctgggactataggtgcgcaccaccacacttggctaatttttgtggggttttt
ttgtttttttgtttttttgtttttgagatggagtcttgctctgtcttgcccaggctggag
tacagtggcgcaatcctggctcactgcagcttctgcctcctgggttcaagcaattctcct

Exon  9 +      39577      39645   1   Internal     69   100   Excellent
aaaatatccttttctactgatactactgatttgggacatattctataatacttattaaat
ccaacttacatacatatttattgaaaacattttctatatgtgaataaaatatttgtttat
taaaggagaggatacaatcctataattttttatctgctttcctggtttctttctaatcag
ATACTTACGGCAATAAAGCAAAGAAACAAAAGACAACTCTGCTTTTCCAGAAACTGTGCC
AGGATCACG
gtaagaatagtttggatcgattcatatttaaataggttttgttttatttactttattcag
tttttcaaattttattatttttgttttgttttgttgtttgtttgttttttgagatagcat
ctctctctgtcacccaggctggagtgcagtagggcaatctcaactcactgcaacctctgc

Exon 10 +      43096      43256   1   Terminal    161    65    Marginal
tcattttttaaggggaagaagtttccttggaccattcgcctttcttagatgtcctcactc
cctgtgatctcataaaactgcctatttgacatctctatctagaaatctaattaaagctca
cactcagcatatccaaaactgaattcttggtcttccctcccaaacttgcttctccttcag
TCTTCTCCAACTCAGTAAATGGCAATGCCATACTTCTGGTTGCTCAGGCCAAAAACCCTG
AAGTCATCCTTGATTCTTCTTTTAGCACCCATATCCAATCCATTAGCAAATCTGGTAGAC
CCTACCTTCACAATATATCTAAAGCTGACCACCTCTTTTGA
cctctactattaacgccctattccaagccaccatcatctcttccctggattgaagctgtc
atctacaaaaattcttcttatatccttgcattcctacagtctgttccccataaagtagcc
agaatgattatttttaaaacaagtcaactcataccattcatctgctcaaaaccattcatt

--------------------------------------------------------------------------------