--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (7413 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        368        508   0     Single    141    47    Marginal
atgatttttcccgaggaactctgtaatgttcatgtgcccatcgcagtccagcagtggggt
gggagaagggtagactcgatggcccggcaggcccctggaggaggctgccctgaggctgtc
gcgacggcagtgaccgctcgggacagaccctaactagaaacctagaatgaggggaccgct
ATGCCGTGCGGGGCCCGCGGGCTGTCCCACTCGAGGGCTGGAGCCGGCATCGCGCATCGA
GTCCGCTTGATACATGAATCCGTGTGTGCTTGGGACGGTGCCCGCTTGTCGACTGACTTG
GCCGACGGACGCCGGACCTGA
tggtgggcaatcgaggtcgcctgcccacaggactaggggtgccctgccctgggagggcgc
gagggcatggcagagggacggggcggcccaggtgcccgggtctcggcctcgtgacctcgt
tgctcgtcgtggggctgccgtccacttgcactgggacaatccttggtccaaggcgcccag

Exon  2 +       1382       1426   0    Initial     45    95   Excellent
cccactggctgctctgaaaagccatctttgcattgttcctcatccgcctccttgctcgcc
gcagccgcctccgccgcgcgcctcctccgccgccgcggactccggcagctttatcgccag
agtccctgaactctcgctttctttttaatcccctgcatcggatcaccggcgtgccccacc
ATGTCAGACGCAGCCGTAGACACCAGCTCCGAAATCACCACCAAG
gtgaggctggacgccgcccgccccctcggggtccgcgcgccgccgctcgggcggtgtttg
gcgcgcagcagctggactgtctcaagcccgctgttgctccctctcgcggggaaacggccc
gcccccggcgcggtgccctcaggcagcccactctttgtgtggtgcgggggagggggcggg

Exon  3 +       4586       4658   0   Internal     73    96   Excellent
tggagggtgttgactggagaagggtctctggggtgggcttggcttggctgggctgtagat
gcagccgccagcctctggtgggaggccgggcatcaggagcaacgctctgtccagcctggg
gccagctggtaatgacatggcctgttttctgtcgaggagaatgaggaaaatggggagcag
GAGGCTGACAATGAGGTAGACGAAGAAGAGGAAGAAGGTGGGGAGGAAGAGGAGGAGGAA
GAAGAAGGTGATG
gtgagtagccttgtctatcttccccttttcaggtactttttcctggccttgtctggcaga
aggggaaggaaggaattggggctcctgggagtgggacaatggtacttggggccagtggac
cacatggccctgggcacccacctgtagagtcagggaaggtctccctgacatggagttgtg

Exon  4 +       5118       5191   1   Internal     74   100   Excellent
tgggcctctctcctctggagagtcccacctgtgtagtgggcgtgggtgccctgattgggc
ccagttgcaggcagtagaggcagggcagggaccttgcagtccactacatgttcctcggga
tttccccaggagccacagtaggagggaagtgtggtttacctggcctttgattctctccag
GTGAGGAAGAGGATGGAGATGAAGATGAGGAAGCTGAGTCAGCTACGGGCAAGCGGGCAG
CTGAAGATGATGAG
gtgggttctggcttgagaagaaggggggtttggcatctgggtctccccacctgcctttag
ctgaggtgctcaagctgcggagggactgtttctgactttgtaggtggccactgtgtggtc
ctgaatcttaagaacaggaaggaaacagggctgggctcaacttcccagaggccttgggct

Exon  5 +       5479       5526   0   Terminal     48    96   Excellent
ccactgtgtggtcctgaatcttaagaacaggaaggaaacagggctgggctcaacttccca
gaggccttgggctgtggagctgggggtccctggttcttgctctgccagcaggagctgagg
cagtgggctggatagggctcctggggttggaggggcctttgacagtctttctctgcttag
GATGACGATGTCGATACCAAGAAGCAGAAGACCGACGAGGATGACTAG
acagcaaaaaaggaaaagttaaactaaaaaaaaaaaggccgccgtgacctattcaccctc
cacttcccgtctcagaatctaaacgtggtcaccttcgagtagagaggcccgcccgcccac
cgtgggcagtgccacccgcagatgacacgcgctctccaccacccaacccaaaccatgaga

Exon  6 +       6812       6918   1   Internal    107    72        Good
caggcctcacaggtttagctccatgacgtggctccccctgctggtggcacgtggtacccc
ccggcctcttagaatgccggggttttggtttggcactggtgcagcctggcagtcatccaa
cctttggtctccaggtcccttaggttagttgggcaggcccaccctgccccttgaacacag
TTGGAGAAGTTACTGTGCCGTTTGGATATTCATACACGGGCTGTGAGCAGTGGGTCAGGA
TAGCCAACTGGAGGAAGTGCCACCAGCTCGTGCCCTCAGAGGTGGAG
gtaaggattagagctcacctagaaccttctgggatcctccaatgagagctgcaggggcag
gggccggtataggcactgctagtgggcctgttgcccaggtaggacctgaggaagccatcc
agtggtatctgcaggaaaactcccaggagcagactgaagtgtctgcagaggcctggcctg

--------------------------------------------------------------------------------