--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (34558 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        198        248   0   Internal     51    53    Marginal
tgttcaaaaaagaatgctatggcgaagtaagtttggaaaacaccattataggattcttta
ctgtagtactttggcggggcgaaggtctttaatttgttcatcatttagaggagttgccaa
cctgggattattttgtaaagtttctcaaaaacctgtttgatgatggacttctttttacag
GCTGACTGTGAGATCAGCACTCAACGTGGAACACCTGTTCTCATGCCTGAT
gtgaggcagtggcaccctagcacatccctccctggttcttctgctttcccctgtgacctg
cagcgtcaacttgagacaacttttcttctctgagcctgagtttccttactctaagataag
gaaaataatatactttccctatgggtttgatgtgtggactcatttttgttgttgtttgtt

Exon  2 +       1261       1302   0    Initial     42    88        Good
ctgatcttccaacccagtgaggggaagaggatgtgatcatgcgaccgccagcagaaggga
aattgtgaaagcgacctgctgtagaaaaggcggcccacagccacctcagcatgcagagga
ggcccagctgctgagaggagttgcctgagagtgacctttgcatctgcctgtccagccagc
ATGGAACCAAAGCGGATCAGAGAGGGCTACCTTGTGAAGAAG
gtgagcgaaggtgccacttaccagggtgtcagtggacatgggctggggagacttgggttc
agctccaccggctacctgctcatcttaggaatgtttcctgttcaaccagttgggttgaaa
taggggagcgtggtagcacatagaatgttggagtggggttaggggagtggggatactcat

Exon  3 +       2336       2424   1   Terminal     89    84        Good
gctttttagttgaatgaacagtgaatgtgagtctgttttaggctactcatttgtttcacg
ttttaacctacaatgttctacctgtaaggggggttaaatagcacacattgctgcctgctt
ccattttgacttcaggctggagggaccctaggtcatctggcctaattccttcatttgcag
AAGAGGAGACAGACCCAGAAGGCTCGGTGATTGCCCCAAGTCACATGGCTATGACAGTTG
TGACCAGCCACTCCTTCTCTGATGCTTAG
gtttctgattcatggcactgaactttgttcattactccagcattttcttaaagcagattt
attccaagttaggatttgtagtgtatttgtgatggtgagagctatgagttggtactggag
aataagtgggccctcagctgctaatctctgtagccagctgtgcttcgaaacatcctttgg

Exon  4 +      15854      15977   0    Initial    124    48    Marginal
atttggcagtttgggaaatgatcttcttttgtattattttaatgaacatcccctgtgtgc
tcagtatcatgaaccaaggaaagtacctgataatgtaattgccatggagaaggaaagata
accatactgaagacaattaaagaactacatgaggaaatatataacaaagttccaggttgt
ATGGCACAATCAGTGAGAAAAGCAGGAGGCACCCCTGAGATCACGGTGGGTCTGTGCAGT
TCGGGAAGCCTCATCAATGAGGTGGCTAAGCTGAGCCTTGAAGGATATGGAGAGGTTAGG
CAAG
gtgagaaagaggagagggcagagttggggaggagtattccagagaatggggttggcttga
gcaaagagccgggagtagaaatgagaatggctccccaagtagccactgatttgagaggat
ttgtgttgaaggaacagagatgatgtcaccaaacattttaaaaaccaactgtaagtaaat

Exon  5 +      16237      16392   0   Internal    156    93   Excellent
aatgagaatggctccccaagtagccactgatttgagaggatttgtgttgaaggaacagag
atgatgtcaccaaacattttaaaaaccaactgtaagtaaatatagaatctttcctgttag
gaggaaaatacagtttgcaaagagccctgtccatctcagctcttttggttgtcattacag
GGGAGCGTGTTCAATACGTGGAAACCCATGTGGGTTGTATTGTTAGAAGATGGAATTGAA
TTCTATAAGAAGAAAAGTGACAACAGCCCCAAAGGAATGATCCCGCTGAAAGGGAGCACT
CTGACTAGCCCTTGTCAAGACTTTGGCAAAAGGATG
gtaagttgacatcatgagctgccgtgaacccctggtcaggcactcaacttttggtgcaag
cattgcctacaatgtgggtggtgctccttgggctggtccctctcaccaccacccacaccc
caccctggcatttgggtttctcttggctagaagaggtttaggccaatggcctctgcttca

Exon  6 +      16632      16813   0   Internal    182    97   Excellent
gcattgcctacaatgtgggtggtgctccttgggctggtccctctcaccaccacccacacc
ccaccctggcatttgggtttctcttggctagaagaggtttaggccaatggcctctgcttc
atgaggggccccaagcccttgaaataagccatttctaatgggatgtgttttgattttcag
TTTGTGTTTAAGATCACTACGACCAAACAGCAGGACCACTTCTTCCAGGCAGCCTTCCTG
GAGGAGAGAGATGCCTGGGTTCGGGATATCAAGAAGGCCATTAAATGCATTGAAGGAGGC
CAGAAATTTGCCAGGAAATCTACCAGGAGGTCCATTCGACTGCCAGAAACCATTGACTTA
GG
gtgattttctgtgtttacttctctttacccattccttctgaaagacacaaacatagcaga
tcctgctccaaggcttgctttgaccacctctgatgttgtatccactctgccaggtcaata
ctggcacttggtgtactaaaatgtttacctgggtctgaaggagtgatccaaggcctacta

Exon  7 +      18451      18616   2   Terminal    166   100   Excellent
tgaatgttgcccctccactacttatgatctgatggagggagattaagctcaggggatacc
tggggtgggggagcttgtgctcacctcccagagagaacttaccattctgaaatgttcccc
actcatccaactgggtttttttttgtttgtttgtttgtttgcttttttatctctgtgcag
TGCCTTATATTTGTCCATGAAAGACACTGAAAAAGGAATAAAAGAACTGAATCTAGAGAA
GGACAAGAAGATTTTTAATCACTGCTTCACAGGTAAAAGCACTTGCAGGCCTGAAATAGG
GCGACTGGGAAGGCGATATGGAGTCCTCCTTCGGCCTCGTCTGTGA
ggtgggggtatgaagtatgggggttggaaggggtcccagaatgcagcctggtgagcctga
ggatgaagctcctacagagtgaaaatagaaagaagtttgttgttcaagctaacgattttg
ttcaagctttatttgttcaagttaacatttgttcaagctaacgttccaatcaaaggattt

Exon  8 +      20794      20834   1   Terminal     41    53    Marginal
aacttgtctttcaagcttcagcatgcctcactgagtgagcgtggatgcaagggttagaac
acttaaaagtgacagcccagagcagttgtaactttggcctaagatcactcagattccctg
agccttaattttcttatccttaaaatgaggactgcaattaccaccctgcctctttcacag
GCTGCTATGAAGATAAAAAGAAGAAATGCAGTGTCACTTAG
tttatctttgtagagaaagaaaagtgagcaaaagcctttcatacatgaaattcatggaag
gctcgctatccaactgctgtcactcctgttttgagggtggcatccctactgcttttgccc
ggatgacaggacaggcaggctgtcatgttgactcccttgttggctacatttgtaaggaac

Exon  9 +      20879      21005   0    Initial    127    42    Marginal
ttgtaactttggcctaagatcactcagattccctgagccttaattttcttatccttaaaa
tgaggactgcaattaccaccctgcctctttcacaggctgctatgaagataaaaagaagaa
atgcagtgtcacttagtttatctttgtagagaaagaaaagtgagcaaaagcctttcatac
ATGAAATTCATGGAAGGCTCGCTATCCAACTGCTGTCACTCCTGTTTTGAGGGTGGCATC
CCTACTGCTTTTGCCCGGATGACAGGACAGGCAGGCTGTCATGTTGACTCCCTTGTTGGC
TACATTT
gtaaggaacacactgctttttatttttatcttttttaattgacacataatagtacgtatt
tatggggcacaattaatgttctgatacacatatacattgtgcagtgatcaaatcgtggta
actagtgtatccatcacctcaaatatctatctttttttgttgtaagaacaaacatgctgt

Exon 10 +      22411      22595   1   Internal    185   100   Excellent
gtttgtttgtttgtttctagtgggtatctatcccacttattttgttttctctttcttgaa
ataacaggggagacgagacaagtcagacctgtgggtgagctggagtcagttcaggggtga
ttgtcaggggcttgttcttcggtaaggagagttaaccttccctgtgctggtcccatctag
GTAACTGCGTCATTGATTGGCTGGTATCCAACCAGTCTGTTAGGAATCGCCAGGAAGGCC
TCATGATTGCTTCATCGCTGCTCAATGAGGGGTATCTGCAGCCTGCTGGAGACATGTCCA
AGAGTGCAGTGGATGGAACTGCTGAAAACCCTTTCCTGGACAACCCTGATGCCTTCTACT
ACTTT
gtaagaaaagctccccatctcttcttcctgtaagggaggctgccctgagcagattctaga
ttgatttcagttcatagacatctatagagcgctgttaggcagcgggtagggaggtcagcc
aggaagaacaagggaatacctgaagctcccaggcccatttagagcttctgttataccagc

Exon 11 +      24296      24400   0   Internal    105    78        Good
aaaggaggaggagaaactcgctcatcaaggacctttgaagttcagattgggatgtacaca
ggaatggaggaaaaaggaggaggctgccctcatggctggaggggagggggaatggagatg
gcacaagttgcaatgtgcctaagactggtgatgttagcttgctgtttgattttccaacag
CCAGACAGTGGGTTCTTCTGTGAAGAGAATTCCAGTGATGATGATGTGATTCTGAAAGAA
GAATTCAGAGGGGTCATTATCAAGCAGGGATGTTTACTGAAGCAG
gtgagtggccacaactgctcccatctagccttttccctttacaaggtcctttttgtttct
aagttacccagtgacttttggtttgtttggttaatagtcaagcagaaaatgaaacccaca
aagtgaaagatagatgagtagctctttagatatcaaagtggctttagatcaggaagattg

Exon 12 +      25663      25814   0    Initial    152    56    Marginal
gtatggattttgagtttcacagggggaagtgggacattcgaatggaaaaattaccttcat
atcaggttttaagagaacagtgtcctaagaaatatatggcaagaatttataaagaattca
tggactattatagtatttttttatgacagggtgaccagctggctagattaaaagaaaggc
ATGGGGCAGAGCCAGCCTTATGCCGGGAAGGCTCGGGCAGTTGCCTACGGACAGTTTGCC
CGCTGCTGCTTTCTCGTTGGTTTTGCCAAATATTCCTATGTTCCTGGCTCTTTGATTGCA
GGTGCTGGAATGTGGCTGTTAAGACAAGAAGA
gtaacttgggaggaaatttctttattttgttgatttcttccataattctatattgttatc
agttatttcttgaattagttgattgggcaaaccctaatctagaatggggctcttggaaag
ccaaggatgaaggctaacagtagataaagttgggactggactggagccacgtctcagtga

Exon 13 +      30016      30111   0   Internal     96    58    Marginal
gtggaggatctggaaggaccttagatctgtcagcagtttttctttaatctccttctgctc
ttacttattttggggggccctgatctatattagagtgagtctggctttttcaccaagagg
atgaggtctatctatactctgcattttggaaacataatgaacaactcctttcttctttag
GCAGAAGATCCCCTGGGAGCAATTCACTTGAGAGGCTGTGTGGTGACTTCAGTGGAGAGC
AACTCAAATGGTAAGATGAATTTCTGTGTGAGAGAG
gtgggtctgctcagactcccctcccacacctggacatcctgggccaacattaatcaatca
atcaattaatcaggataagcaggaatggggcaggcatggtggctcccacctgtaatcccg
gcactttgggaggccgaggagggcagatcacttgtgatcaggatttcgagaccagcctgg

Exon 14 +      30613      30695   0    Initial     83    49    Marginal
tactctgtctcaaaaaaaaaagcaggaatgaatttactgtctgaaaaccttggagaaacc
agagttattttttgtctcccaactgctgtccaggctctccaggccttggggagttggatg
gctttgtggatgcctcaagcaagtccctgagcaatgctgggaaaactctatcacttcaca
ATGGCTGAGAAGAAGAGCAGTGAGGGGGTTGCACTAGAGGACCCCAGACCACAAGGCTAT
GATTTGGTGCATGGAATAACCAC
gtgggtgtagtttgacttctcaggtgctgaggacaaattgtatctctggggtgatgtggt
tttgacatcccaaaccctggttttgtcctgacattttggtttgtagtatgataaaggctg
acaggaaaacatcataactgcaaatgcctagagttttactgtgcctgaatttgcccacct

Exon 15 +      31589      31725   1   Terminal    137    96   Excellent
atgtatataactgtgcaatgaattatcctataatcataccttgtttgtatgtttgaaagc
cacatagtcaatttccttagaacacgaagaaaacagagatttcatggcttgcagaggagg
gtggagcaagtggtctttctgatgcctgtgcgtgctgccatttgccttctctttccccag
GCAGGAAGAGTGAGGAAGAGAACCTTTTTGAGATCATCACAGCAGATGAAGTGCACTATT
TCTTGCAAGCAGCCACCCCCAAGGAGCGCACAGAGTGGATCAGAGCCATCCAGATGGCCT
CCCGAACTGGGAAGTAA
agagactcctgcattcctcctcccctcctgagggaagcccatggacaagctcagtccagg
acctgtccacttctgtgacaaatcaacgggaaacagcccaggggtgggaagttttcattt
gcaggggggtctgaatgtaactcaccatgtggtgtgcaaggttcccctgcattgtattgc

--------------------------------------------------------------------------------