--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (226131 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (52 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1972       2234   1   Internal    263    62    Marginal
tctagccccagatcctgcaccttggtcccctccccgtcttcccacgcccctgctgcccgc
gcggtcttgcgtttgtccccgaagtcctgtactccttgccggtcctgcccacccctctgc
ctagtgcgcccctctctaccggccgcggatcctcacgctccacccctcccggctccccag
CGCCGAGCCTCGCCGCTGCCCTCCTGCGCCGCCGCTTCCTCCTCTCCCTGCCAGGAGTTG
AAGCGGAGCTGCGGCACCTCCCTGGCGGATCTGGTATCCCCGCCCGCTGCCGAGGCTGCC
GGCCCTCTCCCCTGGACCGCTACCCGGAGAGCGAGCGGCGGGGCCGGGATTTGGCTGCGT
GTTGGCTGAGTGCGACACACCGCGAGCGCGGGCAGTGGAGGTGCCGCGGCGGCCGTGGCC
GCTCGGGGCGCAGCGGTAGTCAG
gtgtgtgtgtacagcgggggacgcgcgctgccggctcctgggctggcgacagattgtgca
ggaatgcgaggaatgcaccaggggcagagtccacacagcccgccgcggctgccctagcgc
cttccctccccagctctcgccgcgcagccagaggtcaccggagcatcttcggagctggtg

Exon  2 +       4602       4648   1   Internal     47    91   Excellent
attttagcatttctatgaccttgagtatttggattaggtttaaattagaatcgcagtttt
cttccttttcttgtaaataggcaaagtaaatttaatgtaaaaatttgaaactcgctttaa
tttttgaaaatgcaattattggcaatttttgaccttagtaatttccatgctgttacccag
GGATCAATTTAAATAATATTCATACCCTGGATGATGCCAACCATCAG
gtaagtctagtctcttacctgactcttttgaaatattaaggtattttgagaatgctctgt
aatctaatgtgtttttctttctgtttcaattgagcagtaattccctaccttgcttaattc
taaaatggacatcatatcttcattcttaaatggaaggtaaaatagaggttactatagggt

Exon  3 +       7065       7242   0    Initial    178    76        Good
ataatctctgtggtcctcgttttgctcatctgtaggatggagtgataaaagtacccactt
catatggttgttggggagattaaatgaattaatacatgtaaagtgcttacaacaggagct
ggttcagagccagcgcttaatacattgaaataattatttttacattgtggtgcttttatg
ATGGTTTCTGCAGCATTTACCAAATGCCAGGGAAATTATTGGCTTGCTTTCTGTGTGGGT
TTTGTCAAAATGATTATGGATTTCAACAGGATATTTCAGAGAAGAAATAAACTGCTGAAC
AGAAACCATTGTGAGCTTGATAGTTTGCAGGACATTGTAGAAAAGAGAATCCAGCACA
gtaattaagggcctttttaagtagggaagttgtagcttcttgcggtaggcaatacttaga
gaggcattaaccaccgctagccaacaagtataggagaatgtatacaattattgcgtttgt
aatcccaggtagtagtcattttataaaatgtctttgctagtcagtacatgaataaagcgt

Exon  4 +      11340      11460   2   Terminal    121    48    Marginal
aaaatttcatagcttgttttgacctagttggtatagtaagtaaacctttgtttggtctta
atatagtagatagaaatattcttatacattttggttgtccctttcccaacctcacataat
cactgtaataaaatttacagaaggaaagatcctgtgtaccctttatattgttttccccag
TGGTAACATCTTGAAAACTATATTACAATGTCACAACCAGGATATTAACATTGATGTAAT
CAAGATACACAACATTTCCATCACCACAACGCTCATCTCTCCTACTCTCATCGCCTCCTA
A
atctctggcaaccattcatttttcattacaactatagttttgtcattttaagaatgctag
tggcctacacctgtagttacagctactgaggaagctgaggtgggaggatgacttgagcct
gggagggcaagactgcagtgagccatgatctcaccactgcactctatcctgggtgagaga

Exon  5 +      12921      13005   0   Internal     85    57    Marginal
cagtattttcctatgtgattggaattaatccagtcgttaggttgaagccagtaagcatac
ctgatactttaaaaggtgaggattgtttcattcctagaagaaaagaaattagacattttc
ttttcttcttcttctttttttttttttttttttgagacagggtctcactctgtcacccag
GCTGGAGTGCAGTGGCGGTACTATTATAACTCACTGCAGCCTCAAATTCCTGAGCTCAAG
GGACCCACTCGCATCAGCCTCCTGA
gtacctgggactacaggcacatgctaccatgcccgactaatttttttgtttttgtttttt
gtaggggcgatctggccatgttgcctagactggtctcgaactcctggccacaagcaatcc
tcctgcctcagcatcccaaagtgctgggattacaggcatgaaccaccatacctagccaga

Exon  6 +      14523      14660   0   Terminal    138    90   Excellent
cccttctcttctaaccttcagtggctctccattgtttaccctgctggatcatattcacat
tccccagcgacctaccatataaggcccgttacagtcaaaccttaattactctccttcctg
aaccctccacatcagcaagtctagtttctactcattgttctctgtctccctccactctag
GTTCACATCTTCAAAGTCCTTCAAGACCTAGTTCAAATAGATACTGTAATAGTATCTAAC
TTTTTTGTGGTAGAAAGAAAGAAAGCGCAGAGATCCTACTCTGATGACAACAAGAACAAA
AAACACAACACAATCTAA
ttcattattttcttcaacccatcagagagttgaaatatcataaacaactaacctgaaatc
taaggaaggaaaggcatctccaaggttggacttgcttacctgggacagatgatgctggac
actagtaagaagaactgagttaaaaatgtttagcaaattgctaagtgttgaatgtgggca

Exon  7 +      41157      41282   1   Internal    126    62    Marginal
aataacctattatgaattcttcctgtaaaaagacatttaggttcctgcactcttgataag
ttgcctttttcattatatcttgaaaaaaattaatggtctgaagtcccactaacagatttt
tttctatgcatttttagtgatatgttgatttccttaaaagaataatttggtattatacag
GTGTGCCACGATTCTTCAGCTCTAGGAACTTGAAGCAATTCAGCTTGGTTAAAGATGAAT
CAGGTTCTTTAGGCTATCCATTGGACAGTGCCTCACCTAGAGATGAAAAGATCCACAGGG
CCAGGT
gtcagggaaggggaacagagcttccaccctgcaggaacctccatgcattcaactatcggg
aagctcctatgtatttttaaatgactagagtgatattctaacaatactttcagtgttacg
cagtatttgcatttgtatttgcattttgagtggcctgccttttcctcttggttctttgcc

Exon  8 +      42991      43074   0   Terminal     84    67    Marginal
gcctgttctagaaccttgactcctctgtgctctgctctgataaactcctgctcagtttgt
tcatataatactgttgacccagtgcctgcattaggtgggttgtgagtgtttttttttttt
ttttttccttcaggggtgagagatttttggtgatcattcaattctgcctctgctaaccag
GCACAGCTTTCTGCAGCACAGCTGATGGTGGTGACAGCACAGCCTGTGGCCACAGAAGAG
AACAGAACTCCTGTGCTCACCTAA
ggattaagcccacggggctggtgcattagctcagtgctcctggattcaaaacagttgtag
aatatgttcaggaagaacggtaaaataccctccaatgagagagcctgcggtaggggtgcc
ttcagtggtccaaaatggcagttacttcagattctccacaatctgagcagtttattatac

Exon  9 +      45658      45797   1   Internal    140    57    Marginal
ttgctacatgccaggttggtttatatgtgtctgtttctcagcattccacagatgccacat
tactcaaagctgtgcttttgtgcatcttcacagatttctctctccctaccctgcacagcc
tccctacctgagtttctcatctagcagctgcctgcatgccctgctgacatccatccacag
CACATGCCCAGCCAGCTGAGCTCAACTGCAGTGAATGTGGCTGTAGTGCCAGTGAACTGG
CTGTGCTCCAGGACTTTGCCTCCCCTGCCATGCCATCTGATGTTAAGTGTTTTGTTGAAG
AGGGAGATGTAAACGCCTCA
gtgagggcacaccaaatttcacagatctgtgaaaggtgcatgattattatttcagtctct
attgtgtgcctattttgattcactcttatactgtcttctgtctgcacatccacagtatca
ccatgcagatgtttggctaggtaaggttttcctgtttaaggcaggtggccttgatcttcc

Exon 10 +      49850      50048   0    Initial    199    63    Marginal
tccttgagattggggtagggaggattagtaatgtattagggggtggtgataagcattaag
gtgagaaaagaagcagggtgggtgataggagaagtgagggttttggagtggcagggaagg
gggttcatcaggatcagagtcaggtcaagaaaggcttcttaggtgacgtgactcagcaga
ATGAAGGAAGAGACAAAGCTGGGAGAGGGCATGCCAGGGCCTGGAACTGCAAGTGTAGAG
GTAGTTGCAGGGAGGGATAGAGTGCTGCTGTCCCTGGAAGTACCGGTGTGGAGGAGGTGG
GGTCTGAAATGTGCCCACCTTTCCACCAGCAGATCTGGTGAAGAAGACCATAAGTACACA
GGAGGCGCATCCCTCAACT
gtgagcttcaacagccctgttttgaaaccttaagtaaaagatttgtaaaataataagcct
gaactttttccctccaagctatactgtgaaatgtgaattttaaaaagaatggttgtgtaa
atatgaagaaagtactttcaaattagatgatcagactgcgtttccttcagaattgtgttg

Exon 11 +      59704      59784   0   Terminal     81    86        Good
agtccagccttggcaacatagcaagatcctatctcttgaaaaaaaaggaaaagaaaataa
ttggtactcagccttcagcaaaaacagaatttcatgtttttggtggcaggaatctttatt
gaaaagagctttaatttttctgtaccatttcttaaaagtattaatgtttttccttaatag
ATAAACATCATTGGAAAAGCTGAGGAAAGCCAAATTGTGAAGGATGGAACAATGTCTCTT
TCCATCTACATTTGCTCATGA
atgataataattatcatattgtgggatttcccaaagtatgttcctcagaatgttaataga
tgatcctcaaaaaaaatgggggttggctgacctggtggtgcacacctgtaatcctaacac
tttgagagtctgaggtgggaagattgcttgaggccaggagttcaagaccagcctggctaa

Exon 12 +      66112      66244   2   Terminal    133    50    Marginal
ctcctagcaattttttctacttattattgttaaaatattttgttcatctaatgcttattt
tctacacttttatctgacattagtatctttacattttgaatcaaatttaaatattcacgc
tttctttaacctttattttttattaatttgttcttaggcatcattattttgtcatatcag
TTTTGAAATTGTGTTTCTCATCAACATTTTTCTGAGTGTTCATAATGACAACTATATGTT
ATATTCCAGACAGCTAACTCAAGAAAGGAAAAATAACTGGAGTCCAACTTATTTTACTAA
AAAGGTGAAATAA
agtgtacttggtatgctttcaccaaaaattattagtaaggcgagtagaagggaattaagt
agagaaaaatccagtatttagttgatttgccatctctggaagatttaagacagatgattt
tgtggactattatcagctctggtaaaagagattacatatatattgaataataggttacac

Exon 13 +      67731      68645   0     Single    915    70        Good
aacagaaaggacatccacaccgaaaacccatctgtacatcaccatcatcaaagaccaaaa
gtagataaaaccacaaagatggggaaaaaacagaacagaaaaactggaaactctaaaacg
cagagcacctctcctcctccaaaggaacgcagttcctcaccagcaacagaacaaagctgg
ATGGAGAATGACTTTGACGAGCTGAGAGAAGAAGGTTTCAGACGATCAAATTACTCTGAG
CTACGGGAGGACATTCAAACCAAAGGCAAAGAAGTTAAAAACTTTGAAAAAAATTTAGAA
GAATGTATAACTAGAATAACCAATACAGAGAAGTGCTTAAAGGAGCTGATGGAGCTGAAA
ACCAAGGCTCGAGAACTACGTGAAGAATGCAGAAGCCTCAGGAGCCGATGTGATCAACTG
GAAGAAAGGGTATCAGCAACGGAAGATGAAATGAATGAAATGAAGCGAGAAGGGAAGTTT
AGAGAAAAAAGAATAAAAAGAAATGAGCAAAGCCTCCAAGAAATATGGGACTATGTGAAA
AGACCATATCTACGTCTGATTGGTGTACCTGAAAGTGATGGGGAGAATGGAACCAAGTTG
GAAAACACTCTGCAGGATATTATCCAGGAGAACTTCCCCAATCTAGCAAGGCAGGCCAAC
GTTCAGATTCAGGAAATACAGAGAACGCCACAAAGATACTCCTCGAGAAGAGCAACTCCA
AGACACATAATTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGTTAAGGGCAGCC
AGAGAGAAAGGCCGGGTTACCCTCAAAGGGAAGCCCATCAGACTAACAGCAGATCTCTCG
GCAGAAACCCTACAAGCCAGAAGAGAGTGGGGGCCAATATTCAACATTCTTAAAGAAAAG
AATTTTCAACCCAGAATTTCATATCCAGCCAAACTAAGCTTCATAAGTGAAGGAGAAATA
AAATACTTTACAGACAAGCAAATGCTGAGAGATTTTGTCACCACCAGGCCAGCCCTAAAA
GAGCTCCTGAAGGAAGCACTAAACATGGAAAGGAACAACCGGTACCAGCCGCTGCAAAAT
CATGCCAAAATGTAA
agagcatcgagactaggaagaaactgcatcaactaacgagcaaaatcaccagctaacatc
ataatgacaggatcaaattcacacataacaatattaactttaaatgtaaatggactaaat
tctccaattaaaagacacagactggcaagttggataaagagtcaagacccatcagtgtgc

Exon 14 +      68709      70202   0     Single   1494    91   Excellent
caaatgctgagagattttgtcaccaccaggccagccctaaaagagctcctgaaggaagca
ctaaacatggaaaggaacaaccggtaccagccgctgcaaaatcatgccaaaatgtaaaga
gcatcgagactaggaagaaactgcatcaactaacgagcaaaatcaccagctaacatcata
ATGACAGGATCAAATTCACACATAACAATATTAACTTTAAATGTAAATGGACTAAATTCT
CCAATTAAAAGACACAGACTGGCAAGTTGGATAAAGAGTCAAGACCCATCAGTGTGCTGT
ATTCAGGAAACCCATCTCACGTGCAGAGACACACATAGGCTGAAAATAAAAGGATGGAGG
AAGATCTACCAAGCAAATGGAAAACAAAAAAAGGCAGGGGTTGCAATCCTAGTCTCTGAT
AAAACAGACTTTAAACCAACAAAGATCAAAAGAGACAAAGAAGGCCATTACATAATGGTA
AAGGGATCAATTCAACAAGAGGAGCTAACTATCCTAAATATATATGCACCCAATACAGGA
GCACCCAGATTCATAAAGCAAGTCCTGAGTGACCTACAAAGAGACTTAGACTCCCACACA
TTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGACAGATCAACGAGACAGAAA
GTCAACAAGGATACCCAGGAATTGAACTCAGCTCTGCACCAAGCGGACCTAATACACATC
TACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTTTTCAGCACCACACCACACC
TATTCCAAAATTGACCACATAGTTGGAAGTAAAGCTCTCCTCAGCAAATGTAAAAGAACA
GAAATTATAACAAACTATCTCTCAGACCACAGTGCAATCAAACTAGAACTCAGGATTAAG
AATCTCACTCAAAGCCGCTCAACTACATGGAAACTGAACAACCTGCTCCTGAATGACTAC
TGGGTACATAACGAAATGAAGGCAGAAATAAAGATGTTCTTTGAAACCAATGAGAACAAA
GACACAACATACCAGAATCTCTGGGACGCATTCAAAGCAGTGTGTAGAGGGAAATTTATA
GCACTAAATGCCCACAAGAGAAAGCAGGAAAGATCCAAAATTGACACCCTAACATCACAA
TTAAAAGAACTAGAAAAGCAAGAGCAAACACATTCAAAAGCTAGCAGAAGGCAAGAAATA
ATGAAAATCAGAGCAGAACTGAAGGAAATAGAGACACAGAAAACCCTTCAAAAAATCAAT
GAATCCAGGAGCTGGTTTTTTGAAAGGATCATCAAAATTGATAGACCGCTAGCAAGACTA
ATAAAGAAAAAAAGAGAGGAGAATCAAATAGACACAATAAAAAATGATAAAGGGGATATC
ACCACCGATCCCACAGAAATACAAACTACCATCAGAGAATACTACAAACACCTCTACGCA
AATAAACTAGAAAATCTAGAAGAAATGGATAAATTCCTCGACACGTACACTCTCCCAAGA
CTAAACCAGGAAGAAGTTGAATCTCTGAATAGACCAATAACAGGAGCTGAAATTGTGGCA
ATAATCAATAGTTTACCAACCAAAAAGAGTCCAGGACCAGATGGATTCACAGCCGAATTC
TACCAGAGATACAAGGAGGAACTGGTACCATTCCTTCTGAAACTATTCCAATGA
atagaaaaagagggaatcctccctaactcattttatgaggccagcatcattctgatacca
aagccgggcagagacacaaccaaaaaagagaattttagaccaatatccttgatgaacatt
gatgcaaaaatcctcaataaaatactggcaaaacgaatccagcagcacatcaaaaagcta

Exon 15 +      70314      70417   0    Initial    104    85        Good
ttcacagccgaattctaccagagatacaaggaggaactggtaccattccttctgaaacta
ttccaatgaatagaaaaagagggaatcctccctaactcattttatgaggccagcatcatt
ctgataccaaagccgggcagagacacaaccaaaaaagagaattttagaccaatatccttg
ATGAACATTGATGCAAAAATCCTCAATAAAATACTGGCAAAACGAATCCAGCAGCACATC
AAAAAGCTAATCCACCATGATCAAGTGGGCTTCATCCCTGGGAT
gtaaggctggttcaatatacgcaaatcaataaatgtaatccagcatataaacagagccaa
agacaaaaaccacatgattatctcaatagatgcagaaaaagcctttgacaaaattcaaca
acccttcatgctaaaaactctcaataaattaggtattgatgggacgtatttcaaaataat

Exon 16 +      70491      72536   0     Single   2046    93   Excellent
ttgatgaacattgatgcaaaaatcctcaataaaatactggcaaaacgaatccagcagcac
atcaaaaagctaatccaccatgatcaagtgggcttcatccctgggatgtaaggctggttc
aatatacgcaaatcaataaatgtaatccagcatataaacagagccaaagacaaaaaccac
ATGATTATCTCAATAGATGCAGAAAAAGCCTTTGACAAAATTCAACAACCCTTCATGCTA
AAAACTCTCAATAAATTAGGTATTGATGGGACGTATTTCAAAATAATAAGAGCTATCTAT
GACAAACCCACAGCCAATATCATACTGAATGGGCAAAAACTGGAAGCATTCCCTTTGAAA
ACTGGCACAAGACAGGGATGCCCTCTCTCACCGCTCCTATTCAACATAGTGTTGGAAGTT
CTGGCCAGGGCGATCAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAAAGAGGAA
GTCAAATTGTCCCTGTTTGCAGACGACATGATTGTTTATCTAGAAAACCCCATTGTCTCA
GCCCAAAATCTCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAAAATCAAT
TTACAAAAATCACAAGCATTCTTATACGCCAACAACAGACAAACAGAGAGCCAAATCATG
AGTGAACTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCCAACTTACA
AGGGATGTGAAGGACCTCTTCAAGGAGAACTACAAACCACTGCTCAAGGAAATAAAAGAG
GATACAAACAAATGGAAGAACATTCCATGCTCGTGGGTAGGAAGAATCAATATCGTGAAA
ATGGCCATACTGCCCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGCTACCAATG
CCTTTCTTCACAGAATTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAAAAAGAGCC
CGCATCGCCAAGTCAATCCTAAGCCAAAAGGACAAAGCTGGAAGCATCACACTACCTGAC
TTCAAACTATACTACAAGGCTACAGTAACCCAAACAGCATGGTACTGGTACCAAAACAGA
GATATAGATCAATGGAACAGAACAGAGCCCTCAGAAATAACGCTGCATACCTACAACTAT
CTGATCTTTGACAAACCTGAGAAAAACAAGCAATGGGGAAAGGATTCCCTATTTAATAAA
TGGTGCTGGGAAAACTGGCTAGCCATATGTAGAAAGCTGAAACTGGATCCCTTCCTTACA
CCTTATACAAAAATCAATTCAAGATGGATTAAAGATTTAAACGTTAGACCTAAAACCATA
AAAACCCTAGAAGAAAACCTAGGCATTACCATTCAGGACATAGGCGTGGGCAAGGACTTC
ATGTCCAAAACACCAAAAGCAATGGCAACAGAAGCCAAAATTGACAAATGGGATCTAATT
AAACTAAAGAGCTTCTGCACAGCAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACA
ACATGGGAGAAAATTTTCGCAACCTACTCATCTGACAAAGGGCTAATATCCAGAATCTAC
AATGAACTCAAACAAATTTACAAGAAAAAAACAAACAACCCCATCAAAAAGTGGGCGAAG
GACATGAACAGACACTTCTCAAAAGAAGACATTTATGCAGCCAAAAAATACATGAAAAAA
TGCTCATCATCACTGGCCATCAGAGAAATGCAAATCAAAACCACTATGAGATACCATCTC
ACACCAGTTAGAATGGCAATCATTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGT
GAAGAAATAGGAACACTTTTACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGG
AAGTCAGTGTGGCGATTCCTCAGGGATCTAGAACTAGAAATACCATTTGACCCAGCCATC
CCATTACTGGGTATATACCCAAATGACTGTAAATCATGCTGCTATAAAGACACATGCACA
CGTATGTTTATTGCGGCATTATTCACAATAGCAAAGACTTGGAACCAATCCAAATGTCCA
ACAATGATAGACTGGATTAAGAAAACGTGGCACATATACACCATGGAATACTATGCAGCC
ATAAAAAATGATGATTTCATGTCCTTTGTAGGGACATGGATGAAATTGGAAACCTTCATT
CTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCACATATTCTCAGTCATAGGTGGG
AATTGA
acaatgagatcacatggtcacaggaaggggaatatcacactctggggactgtggtggggt
ggggggagggggaggggtagcattgggagatatacctaatgctagatgacgagttagtgg
gtgcagcgcaccagcatggcacatgtatacatatgtaactaacctgcacaatgtgcacat

Exon 17 +      77289      77420   0    Initial    132    65    Marginal
agttagtcatatttacttattggttacctgtttagaaaatttagcaatttcacaagtttt
tgatcatggtgtgtagactgtagtctactgtagttgctaggaaccatctgtaaagccttg
gttcctgcaagggagcccagaagaaagtgttaaccctttgcctgcttgattgcaggagga
ATGCCAGCTCCTGAGCAGGCCTCATTGGTGGAGGAGGGGCAACCACAGACCCGCCAGGAA
GCTGCCTCCACTGGCCCAGGCATGGAACCCGAGACCACAGCCACCACTATTCTAGCATCC
GTGAAGGAGCAG
gtacatcctcgtattgaaagttgcagtgaattatttctttaatgcctttaaaaaattaat
ctttggatatgttttaaatttgtgtaacgtccttgacgccttcacgttttctaattataa
ggtgtttacatccctgagtacattgggatgactggcatgtagagccgctccaggtgccag

Exon 18 +      90789      90920   0    Initial    132    69    Marginal
cacaggaaagaaacgtgaaattttggttgagagaagtagcaccatagggcatgagccaaa
aaatgtagcagtaggcagcccaagagaggtgtcaaattcaaactaatttcacttttgaga
acaagatttcctctcagacagtgcagctcagaggatagaagataagcatagaaaaacagc
ATGGGATCTTTGAGGTGGGCACAGGTTAAGGATAAAGAGCAAGGGGATGTGATTTACAGA
CATAGAGACAGTACGAAACCAGGCCTGGTGCATTGCAGAAATGCTGAAATCTCAAAGTTG
AGAGAAGAAAAG
gtcagaggattggcttcacagagaggctacagtaagtaaaaaggcctcttttttatgcag
taagataagaagtagaaggtacacacactggaaaggaaaagtgaaactctgtttttcaca
aaggatattattgtatatatagaaaattcttaagcaggaaggagcaaactatagcctaca

Exon 19 +      92520      92620   0   Internal    101    93   Excellent
caagagtattttaagattggaacagttatactcatatttatgaaaaaacaaaatttgtgc
ataagtaaaattttaaccctgtggagaaatttaatatttttatttggcttctttatgtta
accctgaagaaattcctttagattattcaacttcataaatgttaagtttcactcctccag
CCACCCAAGATGCCAAAAGGAAAGAAGGCCAAGGGGAAGAAGGTGGCCCTGGCCCCTGTT
GTTGCAGAGAAGCAGGAGGCCAAGAAAGTGATGGATCCCCT
gtttgagaaaagacctgagaattttggcattggataggacatctagcccaaatgggatct
taacccactttgtcaaatgcccctgctactacatcaggttgcagcagcaaagagctgtcc
tctatccagagctgaaagtgcctcttgcgatgaaccagttcaccccggccgtggaccgcc

Exon 20 +      92718      92841   2   Terminal    124    64    Marginal
ggaaagaaggccaaggggaagaaggtggccctggcccctgttgttgcagagaagcaggag
gccaagaaagtgatggatcccctgtttgagaaaagacctgagaattttggcattggatag
gacatctagcccaaatgggatcttaacccactttgtcaaatgcccctgctactacatcag
GTTGCAGCAGCAAAGAGCTGTCCTCTATCCAGAGCTGAAAGTGCCTCTTGCGATGAACCA
GTTCACCCCGGCCGTGGACCGCCAAGCAGCTACTCAGCTGCTTAAGCTGGCCCATAAGTA
CTGA
ccagagacaaagcaagagaagaagcagagacttggcctgggctgagaagaaagctgccag
caaagggaacatccccattaagagaccacctgtccttcgagtaggggttaacattgtcac
cacctttggagaacaagaaggctcagctggtggtgatcgcacatgacatggatcccattg

Exon 21 +      95449      95623   2   Terminal    175    61    Marginal
acctgtggtctttgggtcaactttataaaagtaattagagctattaaataggcacacagt
tttatttggccattaaagctctagacagaaaaccccaaactgtttgcctctaggttgtta
gagaaaaaaacattaattagcattaccattgcttctctgaatcttccctcttccctgtag
TGGACAGTGCAAGTGGGGGTGCCAGTTGCTAGACTGTGAAGCGATTCCCAAGGTAATTGA
TCATATTGACAGAAACTTAGCTGCCTGTTGCTCTACTAAAACCATCTCAGTTAGCATTCC
CCCTTCTGGTATTCAATCACCCTCGCCCTTCCTCAACCTAAAGACTGAAACATAA
ccaagagttaaaagagataacagccatttatttactctaactcctaagggaaaatagtat
tttcctaaagagtaatttctaaaataaaggcatatctgtttctaaaatatttttacttta
tgcagaagtattttttaaatctttgcaactatttatatttgctaatttaccagtacttat

Exon 22 +      96208      96389   0    Initial    182    61    Marginal
gattgtgggaggcagaataatgctctcctccccagagatttattatcccaacgcttggag
cctataaacgttatcttatttcaaaactttatgggtgtaaataagttaaaaaatcatgag
atggggagattatcctggattatccaggtgagttctaaatgccatcacaagtatctgtct
ATGAGAGAGGCAGAGAGAGACACACGAGAAGGCTCTGTGAAGGTGGAGGCAGGGATTGGA
GTGATGTGGCTGCAAGCCAGGGAATGCCAGCTGTCCCCAGAGCCTGTAAGGGGCAAAGAA
GAGGTTTTTCCCTACAGCCTCTGGAATGAGTACGTCCCAGCTTACACCTTGATTTCGGCC
CA
gtgaaaatgatttctgatttctggtttctagaactgtgagaataaatttttgttgttcta
ttccaccaggtttgtggtgattcgttatagcagccataggatgctactacagagtttggc
atcaggaaggggagtctgctgtaacaaatacctaaaaatgtggaattgctgtggaattgg

Exon 23 +      99202      99300   0   Terminal     99    81        Good
actacataatacttgcacagtgcatgtttctgttatgattatttgctatttacttgttta
aataatcctgaatattctaatatgaatagcttccaaagaatatatctcttcttaaaagcc
atgtttaaacattagtacatgttttatttagtgaaatgatattttctaattgttctccag
GTAGTTGAGGAAGCTTCCCAGGCTCCTAAGAAGGCAACATGCAACATCAGCAAAAATGAT
CTGTACCAATCCCTAGTGACCTGTACCAGTCTTATGTAA
attatgagtgcttataaagtaattaaggtttgagttgttcagtccgttctttttctctga
agcctgtctgtggtgtctttgtaattgtgagccagctattctcctgcctagcaggcttta
gggacaccacctttcccatacatgtgtatattaaagaaatgttagctcatcttaataata

Exon 24 +     101859     101992   0    Initial    134    47    Marginal
gctgagaaaatgccaagttttgccagatcctgtatttttacctgttgtttgatatttatg
tcattcataacataatactattaaaatgctttgtttttattgtaatgctttagttcattt
taaaagataagtgtcacagatgtatagtaaagtgataacttaggtttagatccaaggaga
ATGAGAGATGGAACAGGACCTGTTTACGTTTGTGTGTGGAAGGTGATGGAGCTATCTAAG
AGGATGCTTGGGTTTGAAGAAGGCAGCTGGTTACAGATTGCTAGAATTTGTGAGAGTAAA
CTGATGTTCTGCAT
gtgtgtaccttgaggtgattgtggatcatccccaagaagagacccattagatagctggac
acatggacttggaccttggtcaggaagatctaggtcaaagttgtcgatatgagatccaca
accacatagttgttacttgaagccatgggagcagcagaggcatgaagaacacaggcccta

Exon 25 +     109683     109810   2   Internal    128    90   Excellent
ttcaaatctggaacttctttttcttcttcttttttccttttttttttttttttccttttc
tgccctatagatctaacacaagtaagaagtaacattacttgtctgctctttttttggtaa
acagggagtatgcagatattcaataagggtaacgaaaaataaaattgcttttatatatag
GTGGAAGGAGCCAAATGTTAGGGAGAAAGCAGGAGAGTCGGAGAAAAACAGGGACATCAA
ATATGGAAGCACAAGGAACAGAGCACTTGTGGACCCAAAGACTGAAATCAGGGCTTTATT
CTGGATGT
gtatgcactgaggttggacgcagcctgtagctagatgtgcctgagctctcctacagcttt
aatattccttataggttagatatggcttatggttatcaataatacattgatctttcttaa
ccttctttccgaagaagcccacgataatttctggaagtttagaaaggagtgatgatatta

Exon 26 +     111701     111763   0   Terminal     63    52    Marginal
taaaacaaggctgagttggctttttataagtagttttatgggttgggttgggtagagcgt
ggtgcgcagtggttaacccatggggttaggacagattgagatgatttcaaatcttggttt
tgagtgaccataggcaagtcagttctctatgaaatgaggctgactctgactccctcacag
GCTGATTATGTGGAGTTCATGAAGAAATACTTGGCACTTAGCGTAGAGCCTGGAGCCCAG
TAA
accttttgtaaaacatagagattattggtgagtagtattgaacgttggcaaacatatcag
gaaaaaatgtaagcagtggaagcaggaccccacaccaccatggcagggagaagacttaat
gagtttttgcagtagtctaaattaatgtgaacctgaaggaatagtgaggaaggaaatgga

Exon 27 +     115836     115862   0    Initial     27    53    Marginal
tgcagtattttcgagaaagaactacatttcaattaaagcctggaagtggagagtattctt
agtaactcagaggtggagaacattctgattaaaagataaagagtttgtaaagagagagtt
tgtaaactggaatgagacttccacagggcacagttggaaagggtcaggagatatgtcact
ATGGCCATCAGTGAGGACTTAATGAGG
gtaagagactaggaggccacaggaggatgaagtatgacctgctttcagtgttacgtgaaa
atggttcaagggactgagccttgaactggagtggagctcttcctgctcatcaaaggagcg
ggagtgcagagacctaattctgaaagctacctagggtttctgaaagccagaaggaagatg

Exon 28 +     121375     121524   0   Internal    150    89        Good
tgaaaaagctaggaatcaataggtcatttatttcatccaaaaattgcatttcacaaagcc
acaccatagctttatgttatgggtacgttcctatgtttcctgtgacatacattaattcat
atatctgcctgagcagcataccttggcgccttatatgccttttattttcttgaatcacag
GAGCTTCAGTTTCAGCGACTCACCCGAGAACTGGAAGTGGAAAGGCAGATTGTTGCCAGT
CAGCTAGAAAGATGTAGGCTTGGAGCAGAATCACCAAGCATCGCCAGCACCAGGTACAGG
GCCAATGGCTCCATCTTTATGCACACTCAA
gttacatgccttactaggttgttctctatgcagcaaaagattctgttagtgttgttactg
ttaacttgccttccagaatttgaaaccaaaaatgtccatttattctaattttgagaagcc
tcttgcaatccctcagtcctgtgcttgaaatgttttctatagcattggcaagcttctgta

Exon 29 +     122929     123011   0    Initial     83    62    Marginal
actggttttgtttttctaaccagaattatattttaatagaaaagtaattcaacatttaac
agaattctgttagtacttcttattctggcaatattactaactaaattaaaatagaaattc
tcttgataaactcctagtaatacttggtatatcaataataaagaccaatacctagaggaa
ATGGCACAAGAGGAGGGAAAATCCCCAGATATTGAAACTAGAAAGAGCACTGAAAACCAG
AGCCAGAAGCTTGAGCTACCTCT
gtaggagatgtgagaacagttgtcaaacctcaaagtaagcactagaggtggattttatac
ccatagaggagctaaagaatgaagttttgtgtgtgctcaagatggtatgtttgaacttaa
catcactgcactaagccatgtcctttaaaggaccccatgattagcaaaccccaggcttct

Exon 30 +     125052     125153   0    Initial    102    55    Marginal
gccctactttcttctcatgttgaattcccatgtattcttgatgtcccaactaaatgctta
cccttctttacaacctttctcaagtttctcaggaaaagtcacctccctcatctgaattcc
catcactgtttccctgtgcatgttagctgctcaacaggtagtaaggctcattccaccccc
ATGGCCCTGGCACAGAGCCTGGCGCTCAGCAAGTGGGCACCCAGCCAAATGATCATTGAA
TGGATAATGAACCTTAAGTCCAGGATGCTTCGGGCACATCAT
gtaaaggtgctttgccattaggggagctaaagttttttattgtgtcacttgagagatccc
ccttgcatctccagtgtgtttcaattgtcagtcttggaaccagaatctaagtgatacaga
gaagaacagaaattagctcttagacccaggccccctttccggtatgccatttccgatttg

Exon 31 +     133888     133923   0   Terminal     36    52    Marginal
attcaacaactctaggaaacaacctttaaaaatatattgtctgttgccactaatgtactt
agcgcagttaactattttagggggaaattttttgtaattccttcatctaatcactttaat
attcatgatgaaataaaggaaggttggtagtaaactctcattctcattaccatttggcag
GTTAAGGACATAGAGCAACAAGAGCAATATGTGTGA
tgtttccttaacccttcaaagaactaccctagacagctctaatccagtgatgtatgggaa
aggaaactgaaaatgtgattatctacctaaaagtgagggccatccactagtgcgttttca
gcagttaatcagcttgtcgtaaaaatgtacatggcatgtctgcctagggatgggggtggg

Exon 32 +     138943     139062   0   Terminal    120    47    Marginal
caggaatttggaggaagaggttttgttttgtttttgttttcattgagattgattgtgaat
ggacactaagtaaatttggaaggggtttcaaaaaatatagttaaatactaaggaggattg
ctttcagaatatttttgctaagaaatcattactgcctggatttgtgatttttcaaactag
GGTCCTGAGAGCCCCTCCGAGGTGGTAGTGAATGTGGTGGTGGAGATATTTGTTTGCCTT
CCAACTCCCTCGTCCTTCAGCTGGGCAAAGCAGTTCACTTTCACTGTCTTCACGTGTTGA

ccttcctgtcttcaccttactgaactagcttagtgcaatgatgaagagctatccaaactt
gttttgggaagaataatcatgacatattgtttaatttgtgtaactgctctatttgttctg
acgttaagacagagagcataagtctctagtgtaaagaatttatttcccgggcaatcctta

Exon 33 +     143819     143992   0    Initial    174    42    Marginal
atccagtatgcagttggaaatagtctacagttatgagtcttgggcccttttcagagggct
actttgtctttgttagttttaggataacatcagtcaggatttttggttgcaaacaataga
atcttctctggcttatgtaagcagaaaagcaactttttaggagctattggatatcaactc
ATGGAGTCTCTAGGAAGGCCAGGGAGCCAGAATCTGAATCTGGGTTTCAAGGAGCAGTGC
CTACTGCCACCACTGTATCCACCACAAATGCTCAGGATCACCCTATCTCCACATGTGGCT
TCTTGTGAACTTCACTCACTGGCCTGCCCTCTGGCTGGAGGGGATTATGAGCAG
gtaattttctgactcctaatatgggaaacagcaaaataaggagagttttcaaagatattg
cacagctgtcaatgtccaacaaagatatttttgcctccatttgcatctgaatgaaaaaaa
ttaatttcaggagtatgtagaattttatagtgatctacaacatattttcatgtaatatta

Exon 34 +     144430     144543   0   Terminal    114    83        Good
aaatttgcttttgattgatgttcaccatctgactggacagccccaaggttattagtggat
ttcattctaaatgattaagttattaacgtattaaattatgaatatatcttcccattgaaa
caaagttatcatgggtgactcagttcctgtgtgtattttaaaatgtgtttcacattccag
TGGAAGCTCCTAGAACGCAAGCTGCTTGGCATCTTCAGAAGAGAAGTGAAAGGGAACCGG
GATGGAGTCATTTGTGGGCACAGTGCCTACAGACACATTGTAGCCATTCAATAA
aagttgaggaagtgtttctaggaatagatggttggagggagagaaggaggaaataagcct
atgtttctaacatgaagctgcctgtgattgttgtaataaacatgggtttattagaacaat
tgcctttggtggtttaaaacagcatttcaaaattccatctgttttgttgtccaatccctg

Exon 35 +     154981     155159   0    Initial    179    85        Good
cacaatatcacagtttttctgtttgcgagaaaaaaaaattactagagtttaggtggttgc
caacttgagtagatctgtgtaaaatgcaggggaggagaatcggcctcagaatccagcctc
cctccgccccagctcttcctagcacattagaccaggagcagtccgtcttacagggctgga
ATGTGCTGCTCTGTCCCCACCAGCCAGCCAGCCAAGCTCATTCTTTTTAACACTGCTGTG
TTCCTAGAAAAAGAAAGTGTTCGAGAAATTGATGGATGTTACGTAGGTGATAAAGAATTG
GTGCTCATGGGTAAGAAATTAGAGGCCAAAAAAGATTGGAATCTCTACCAAAACAACAA
gtgagagaaattttctggttgactcagaaggcactgaggggttaatagatttggatgaac
aggagagaaaatagtaacaattctgtgcagttaggagttttgatgtttgacagtaaatat
ggaagggaagaaaaaagaccatagtaaaataggaagtttaaaactgattctataacttca

Exon 36 +     164669     164708   2   Terminal     40    93   Excellent
tttggctggaagaaacaatggttaggttagacttgcctatattcctttaaaaaaggctaa
aggaataaaataagcaggtgaacaagaaaattttcattgcttgcaattctaaaactttgt
atagagttcctttgactgtaagtgacatgaaatataacataaaatgtgctctaccttcag
AGGCTTCATCACCAAGCTCAATAATATGAACGTTGTGTAA
gttttcatttttaattgtttggaagatggaggacccttcttgaaatacttggtctccatt
ctcagtcttttaatcccttggaggaaggtgtctgagaggtcagttttccaagaggaacag
gatcagttttcagattttgatttaatattgagacttacaatcacaacaaacaacattcat

Exon 37 +     165125     165219   2   Internal     95   100   Excellent
taagagtcagatgtgctgtgtaagctgaaaataatagccttgtattagcatatagattct
aagatgctgttgacaaacatctgaaccttttttagcaagtttttatgtaatgttattata
tttagctgattaaacttttcttgttacagacgtgccaaatactggtgtaagcaaacctag
AGTTTCTGACGCTGTCCAGCCCAACAACTATCTCATCAGGACAGAGCCAGAACAAGGAAC
CCTCTATTCACCAGAACAGACATCTCTCCATGAAA
gtgagggtctgttgtgttatcttttaagtactggatttgcttttaagattttattcttga
aagcgagtgtcagaagtgtgtataataaagatatttcttggtttcattcttacaggatca
ttgggtaactcaagaagttcaacacaaatgaattcttattccgacagtggataccaggaa

Exon 38 +     165335     165525   1   Internal    191    81        Good
tctcatcaggacagagccagaacaaggaaccctctattcaccagaacagacatctctcca
tgaaagtgagggtctgttgtgttatcttttaagtactggatttgcttttaagattttatt
cttgaaagcgagtgtcagaagtgtgtataataaagatatttcttggtttcattcttacag
GATCATTGGGTAACTCAAGAAGTTCAACACAAATGAATTCTTATTCCGACAGTGGATACC
AGGAAGCAGGGAGTTTCCACAACAGCCAGAACGTGAGCAAGGCAGACAACAGACAGCAGC
ATTCATTCATAGGATCAACTAACAACCATGTGGTGAGGAATTCAAGAGCTGAAGGACAAA
CACTGGTTCAG
gtaagccaaacgcatcaagatctctgcaaagaaataccttccggccgggcacagtggctc
atgcctgtaatcccagcattttgggaggccgaggcgggtggatcacctgaggtcaggagt
tcaagaccagcctgcctaacatggcgaaaccccgtctctactaaaaatacaaaaattagc

Exon 39 +     169210     169542   0   Internal    333    70        Good
agagcacagtctccttcttatgttatcagcacaggcgtgtctccttcaagggggtctctg
agaacttctctgggtagtggatttggctctccgtcagtgaccgacccccgacctctgaac
cccagtgcatattcctccaccacattacctgctgcacgggcagcctctccgtactcacag
AGACCCGCCTCCCCAACAGCTATACGGCGGATTGGGTCAGTCACCTCCCGGCAGACCTCC
AATCCCAACGGACCAACCCCTCAATACCAAACCACCGCCAGAGTGGGGTCCCCACTGACC
CTGACGGATGCACAGACTCGAGTAGCTTCCCCATCCCAAGGCCAGGTGGGGTCGTCGTCC
CCCAAACGCTCAGGGATGACCGCCGTACCACAGCATCTGGGACCTTCACTGCAAAGGACT
GTTCATGACATGGAGCAATTCGGACAGCAGCAGTATGACATTTATGAGAGGATGGTTCCA
CCCAGGCCAGACAGCCTGACAGGTGCGTACAAG
gtgacagtgctacataaaacccagtgaggaaatcttctgtgtaacttaagttgaaacaaa
gaatgaaaaggtggaaaaggctcattcgtgtttttaatctcagattttaaactataaact
taaggttaacttgtctttcaggttctgtaattcttaatacatgaaattatatacatttat

Exon 40 +     174493     174518   0   Internal     26    94   Excellent
tgagcatcataatatagaaaatattcagtctttttaagaaattgaaatgtttgggtttga
agtatacctttttatcatgagtcccatgtgtaaacattagttattagcagtttgaatcaa
aatatttaaaatgatttaaggttcatgtactactaactttgtactttttctttatactag
AAAGAAGGTAAACAAGAATCTGGTAT
gtgagttcttataaaaacagtttttgggtttgattttttttaaaagaaaggaaaaacaat
gataaatagtatttcataataatgttagttcactgataatattacaaaacttatagcaca
aaacttccagtgtttttctgtaaaaattatatgtgagttaattgacatttcaaaacagct

Exon 41 +     175857     176045   1   Internal    189    60    Marginal
gtagagatggggtctcactctgttcccagactggtctcaaattcctgggctcaagccatt
ctcccacctctgtctcccaaagtgctgggattacaggggttaggaatttaattagggttt
atgtttttaacctcactgtgattgtctcagttcttaacgatgtaatttttgtgcctctag
GCTTACGGAGTTCCTATGCTAGTCAGCATAGTCAGCTTGGGCAAGACCTTCGTTCTGCCG
TGTCTCCCGACTTGCACATTACTCCTATATATGAGGGGAGGACCTATTACAGCCCAGTGT
ACCGCAGCCCAAACCATGGAACTGTGGAGCTCCAAGGATCGCAGACGGCGTTGTATCGCA
CAGGTTCAG
gtgggcatcaactctgtttactggtttcctgatttcataggccccacagtagaagtgttt
tattgagattgggttccctgttagaaggaaatcatgttgcccatttggttgtcagataag
cagctgtgacagcagatcaataagcaataaaacaggttcatttagtacctatttataggt

Exon 42 +     184731     184931   2   Internal    201    99   Excellent
catctgggcctctgcatatgttcatcagggggaaaaattatttaggtatgtattttttag
gatttttgtaacttcccatttttgtctcagctgagctttttttccttataccaagtgttt
ttttcagtgtatttttacaacatgggccttcctttctgaagccatgtttttctcatgtag
GGAGTTTGCCTGGCGTGATCCTGAGTTGCCTGAGGTCATTCACATGCTTCAGCACCAGTT
CCCATCTGTTCAGGCAAATGCAGCGGCCTACCTGCAGCACCTGTGCTTTGGTGACAACAA
AGTGAAGATGGAGGTACAGGACATGGTGCCTGGGATGACTGGGGAAAATAATGCCTTTGC
ATTTAACAGCCACGTGCTTCT
gtatttaagaaattacccagtgtaattcaagagtctttttaaagggatattttgatacca
gatactctttcacttaactatgcatttcagtatctctcaggaaaaactaggatacatata
tttcttggagtgctttcagcattttcaaatcgtatgtctacttcattagcttatttataa

Exon 43 +     186598     186820   2   Terminal    223    99   Excellent
gcacctggcctctccttagaatgtataaaagttgtcttatttggaataaaaagtaacctt
tgaaatggtctagagatatccacatcctgtgatctctccataacggacttctgtatgatc
actgattaattgcatgttacttaggcctggtacctaatatttttcattctaggtgtgtag
GTTAGGGGGAATCAAGCATCTGGTTGACCTTCTGGACCACAGAGTTTTGGAAGTTCAGAA
GAATGCTTGTGGTGCCCTTCGAAACCTCGTTTTTGGCAAGTCTACAGATGAAAATAAAAT
AGCAATGAAGAATGTTGGTGGGATACCTGCCTTGTTGCGACTGTTGAGAAAATCTATTGA
TGCAGAAGTAAGGGAGCTTGTTACAGGTAGGTATAGAATGTGA
tctcgtcctagaggaaatgttgaaaacagtctggactgtgcccttgtatagtggcactat
ggaagagttggaggttccaggtaatagataatgagatatatatagtgctcacaactgtga
aggctgagaattatttagtctaatgagtcagaaaccgtttagaatgcagtcatctctatt

Exon 44 +     205474     205554   0    Initial     81   100   Excellent
taccatgcaagcccccagtgcctcctccgacctctaagtggctgccacctgttgttcgct
ctctcagatccttaaggttaagtccacgtggctgatgagtgcatggttcatctcagcagc
tcctcctgtctccacccctttaggaacctcagctccgcgggggaagaagctcggaagcaa
ATGCGGTCCTGCGAGGGGCTGGTAGACTCACTGTTGTATGTGATCCACACGTGTGTGAAC
ACATCCGATTACGACAGCAAG
gtcagtgccggcctggttgcaggagggcgtggtggcaggtgaccatgatgcctggtgcca
ctatttgcatgccattggttctttctgacctgcggatcctgtcctcctcaggaggccact
ctccagatcaaagggcaagtctccaaagttacaggggcaaggacgtggcaacttaagaaa

Exon 45 +     206931     207191   0   Internal    261    68    Marginal
gcctcaagcatttcggtcggcatgaagtcaaatcctcagcaggactgagaagggctctgc
atcctgtcatctgggtattccacaaacactctagaatcataattctctcttcagattgtt
tcaagttctcataaataaaaagtagttctttcatatttcccatttatttcctgtctgtag
TGTTCAGTACAGAAGTGTTTTGCTCTAATGTGCCGAGTTGTTTTTAATTATACGCCATGC
TGGGTTTCAGACGGTGGAGAACTGCGTGTGCACCCTGAGGAACCTGTCTATCGGCTGGAG
CTGGAGGTGCCCCAGGCCCGGTTACTGGGACTGAACGAATTGGATGACTTACTAGGAAAA
GAGTCTCCCAGCAAAGACTCTGAGCCAAGTTGCTGGGGGAAGAAGAAGAAAAAGAAAAAG
AGGACTCCGCAAGAAGATCAA
gttagcattttattttatatgagactctcaagtttaatttttctgggagtgaggaatcac
atatttggcaagaaaataaattttctgcatagctatagctgagtcccgcaaaggtgaatg
ttttcaagtattggagatcatgttcattctgcctccatttaacgtgtgctgtttgtcttt

Exon 46 +     210516     210666   0   Internal    151   100   Excellent
agcctatctttctccccaactttggttttctcttcactgacaccacagatttgatcttca
attggaaagaaaccatttaatctattagttcatcttttggaaacatcttttttaggtgac
agtaacatatgagactggaactctgttttatgttacttcctgccttatttttctcactag
TTTGCAGCATATATCCGGGCGGCCGTCCGAAAAGAAAAGGGGCTCCCCATCCTTGTGGAG
CTTCTGAGAATGGATAACGATAGAGTTGTTTCTTCCGTGGCAACAGCCTTGAGGAATATG
GCACTAGATGTTCGCAACAAGGAGCTCATAG
gtatgttctggtgacaagatgagctgtaaatgtgagagcagctacaaaattcatgaaact
cttcttttgattaataaatatatggcttgtaaaatcattaacagctgagccctagtctcc
agtttcttggcatatttgagtactcctgttttgtgaccattctttttcagcaggaggcaa

Exon 47 +     211329     211445   0     Single    117    43    Marginal
ggggcaggactagggtgagctaagcaaggcgccaaaggcacaacattttaggaggccttt
actctcaggtttgtacaaggtagggttggcacatgcacaaaccaaacagtgaggacctct
gtacgctccgcaccccaggcagcttgcttgcctctgcggcattgccacatcctaggcagg
ATGCGGGCTAAAGAAGACATCAGGGACCCCCATAAACCTGAGCTTCGTTCCCAGGATGTG
CTGCTCACTGGCCATGCAACCTGGGGTATCCTATATAACCCCGTTCAGGCTCCGTAA
ttctatctagattggaaatgaaaggcaactcctcatctctgaaggggagctgttgatgcc
tgctgtcctaactgggtttgctgtaaagaggaaatgagagagctccatgccaagtcccac
agctggtgacaggtcaggggagaaggaggggaaatgggacaagatcttatgtggattcat

Exon 48 +     213823     214085   1   Internal    263    87        Good
gctttccccttataatgacatttgtccttttcttctttgccatgggttttgattttttcc
cctattattgtctctttgggggttttatttttaagagattgcatgccaccagaatctgaa
caacaataacaaaaacctagtaccttctggaagtagaatttactcttttgccgttggcag
GCAAATACGCCATGCGAGACCTGGTCAACCGGCTCCCCGGCGGCAATGGCCCCAGTGTCT
TGTCTGATGAGACCATGGCAGCCATCTGCTGTGCTCTGCACGAGGTCACCAGCAAAAACA
TGGAGAACGCAAAAGCCCTGGCCGACTCAGGAGGCATAGAGAAGCTGGTGAACATAACCA
AAGGCAGGGGCGACAGGCAAGTCTGCGGCAAGGAGGTGCAAGCAGTGCTCTTATTCCTGA
GATTGTCCTGTGATGAGGCCTTT
gttgaggatacctttcctattggaaaggatttatttttgcatttcttacatgccgataag
ctaagcagtctccagcacttacaacctgctatgctgggagaagtgttttctgttatgggg
cctatttttggttttcactttattgtaacaccctcactcctacattggtatttgtctctg

Exon 49 +     215698     215881   0   Internal    184    73        Good
aatcacttatgctcttaaaatgtcgctggacagcctgcacttgtgagcagcataagaaga
ggctgagatgctgagccagtgccagaacctttccatattaagaaaattgctacccagtct
aatctgtttttcaaaaccagagattcggaaagtcctggaccaaatcaaattgtctcctag
CTCCACACACTTAACTTCTTTCACAAGTACTTACTGCCTGCCTGCTGTGTGCCAGACGCT
CTTCTCTATGCTGGGCTTGCAGCAGCAGACAGGTCGCATGACAGCCCCACCCGAGGTAGC
TTACGTTCCATGGGTGAGGTAGACGCAGACAAGGTGCCAAACGAACAGAAACGCGTGGAG
CGTG
gtgggtggtgctgaggggcagggcgcataataatgtcagggtgggtggtgggccatgctg
gggagaggaatgctagtcaatgaaggccttgcagagacagtgccttttgagcacagagct
ggaggaggcagggaaggaacagtgcagctccctgggggaagagcatttcggttagagggg

Exon 50 +     217780     217921   2   Terminal    142    49    Marginal
ttccgaacctgatcgactcccaggcacacctggtccctttgtggtgtgtcctgcagtagc
ctccatccctgtggccctgagagcgatggcctgttggccactgattttcatcctgcaccc
ctctgagtggggctgaggctgtgtcacccacattcattaatatccttgctctctacctag
ATCATCTCTGAAAGTGGTGAAGGCAGCAGCCCAGGTCTTGAATACATTATGGCAATATCG
GGACCTCCGGAGCATTTATAAAAAGGTAACCTACAAGAATAGCTCTGGCATAATTAGCAT
TCATCAGAGCACACACTCATAA
tcatttattgtaatgaaatgtcattattcattttgagaggtttctttttctcttaactct
gcaggatgggtggaatcagaaccattttattacacctgtgtcgacattggagcgagaccg
attcaaatcacatccttccttgtctaccaccaaccaacagatgtcacccatcattcagtc

Exon 51 +     222684     222757   0   Internal     74    57    Marginal
taagcagcagccaggccagatccagggaccctgagctgctacctctcccagcccgcattg
gcactggggaagacaggccctgtcggggacagtgctagccctagtgcaggggagaccacc
cagcctaatggaccagagtaataagcactagttttaatttcataaaatattttcttacag
GCTCCAGCAAACCTTCACCAATTTACATCAGTTCCTATTCCTCACCAGCAAGAGAACAAA
ATAGACGGCTACAG
gtgaatttgcaatatcatttttacagaaggctgattagcagttaacacagtaaggggtcc
acgtcgattgacttcccagagctgggccaacatggcagggtcctagatgctttccctggg
gatcttcactccttggaaactcaacgtgtggtttaagcaaagcatttccacggtagcctc

Exon 52 +     224532     224780   0   Terminal    249    75        Good
taaaatccttagagtccaatagtaaacgcatagtgtgcaccagaaacagcttttaacctt
aaactgcaaatattgaatattgctttaaaaatatgaagcaggaagcccacattaattttc
ctaacacatgtatttttaaaaaattgcttttatttatttgccttttcattttgtcaacag
CATCAACAGCTGTATTATAGTCAAGATGACTCCAACAGAAAGAACTTTGATGCATACAGA
TTGTATTTGCAGTCTCCTCATAGCTATGAAGATCCTTATTTTGATGACCGAGTTCACTTT
CCAGCTTCTACTGATTACTCAACACAGTATGGACTGAAATCGACCACAAATTATGTAGAC
TTTTATTCCACTAAACGACCTTCTTATAGAGCAGAACAGTACCCAGGGTCCCCAGACTCA
TGGGTGTAG
catcaagatgcccaacagaggaactctttctttctaaccttgttcagattgaggtgaaaa
gtccatcttgctgatttgatgattgaaatgtgaaagtgaagtggaaggaatgaatgaagt
gtgttttttttttcttttttgaggaattatcagggaagtgaggaaatgtttgggagagga

--------------------------------------------------------------------------------