--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (42402 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1252       1451   0    Initial    200    76        Good
ccttcccgctccgcgtcccgcccagcggcgcagggggccgggctccggctaggagggtgg
gggccgcgccggtgacagccgatccccgcccctgctgcccgccacgtccctcacgtacca
ctcggcagaggcgcggggaaacctggcgtactggctgtggcttctctagcgggactcggc
ATGAGGCTGGCGCGGCTGCTTCGCGGAGCCGCCTTGGCCGGCCCGGGCCCGGGGCTGCGC
GCCGCCGGCTTCAGCCGCAGCTTCAGCTCGGACTCGGGCTCCAGCCCGGCGTCCGAGCGC
GGCGTTCCGGGCCAGGTGGACTTCTACGCGCGCTTCTCGCCGTCCCCGCTCTCCATGAAG
CAGTTCCTGGACTTCGGTGA
gtgcggcccgggaccttgggcctttttgcgcggtcccgggcggggagctgcggccgctgc
cccaggccgggtcggcgccggccagctctcgcctgaggcgcacccctcctcctcagcgtt
tccgcccccagcgccttaggtgcttccttcctccctccgaagtgccggcgctggctggcg

Exon  2 +       7321       7396   2   Terminal     76    50    Marginal
tcattcccagcactttgcttgaatgtgcatgggtgtaaaaattatacttcaaccataatt
tatagcagtattctaaattaaaaattataaaatgctaaaaatagcttttgagctaatttt
catgatattgaactttcagaatataaaagaacaaacttatcctattgatctgcattttag
GTATATCCAGAGTCTTCAGGAGCTTCTTGATTTTAAGGACAAAAGTGCTGAGGATGCTAA
AGCTATTTATGAGTAA
gttcactattttgaccctattcttaaacctattattaggtcacttgggggaaattggtta
acttttaggtttctactactttagaacatgtgatatatgtgactgtagcagcccatacag
gcaggacaaataacaatcagcaaatttgactaggcataagaaatgcttcgtgttcctctt

Exon  3 +       9209       9320   2   Terminal    112    55    Marginal
gatttgtcttttaatataattgtttacttttcctctcccattttataaactcataggatg
agtgaaatgagaattcttttctgtttttctgtcctaagtgtttccttctctctttgaacc
ctagggaataggtccaaaacaggcaggctttattggctcattcatcttgattccttgcag
AGCAGAGCAGGTGTTCTCTAGAGGCAAGTGCTTTGTCTCCTCCTATGCAGAATGTCTCTG
GAATACCATCCTCTTAGCCAGTGCTCAGATGACCTTAGTTGATAACAGTTAA
aaccattaacattttttggattacgttttgtggcagccttactcttaggaagccaagaaa
agaattaaatcttgaaagttttattttggaggtctgtatactttcatagatttggtatat
tttatgatctgaaatacatttaaataagtataggaaaacatgaaccgattttccttttat

Exon  4 +       9590       9788   0    Initial    199    97   Excellent
aggtctgtatactttcatagatttggtatattttatgatctgaaatacatttaaataagt
ataggaaaacatgaaccgattttccttttattaaattggggattttttgtctagcatagt
tggttaagcttatatttttgtattaagtttacttgtcaaaatatttggctgttttgacag
ATGGGTTTGTTTAGCTTTACAGATACTGTGATACGGATCAGAAACCGACACAATGATGTC
ATTCCCACAATGGCCCAGGGTGTGATTGAATACAAGGAGAGCTTTGGGGTGGATCCTGTC
ACCAGCCAGAATGTTCAGTACTTTTTGGATCGATTCTACATGAGTCGCATTTCAATTAGA
ATGTTACTCAATCAGCACT
gtaagtgtccctcatgagtcaagagaagaagctaaatgagatgtgttggcatattttaaa
tttatttaggaaagttccatttaggtaggaaatttagttttaccttttggctaattaaga
aaaataaatagactgccatcaagaaaggtgtttttattgaatgtaaaatactatgtttat

Exon  5 +      10079      10174   1   Internal     96    76        Good
ctaattaagaaaaataaatagactgccatcaagaaaggtgtttttattgaatgtaaaata
ctatgtttatcctaaaggaaaatatttgttctgtttggtacaatttaaacagtattcaga
tttggaaaagagcattaggtggtttagcttattttgttggtttttttcctttttggatag
CTTTATTGTTTGGTGGAAAAGGCAAAGGAAGTCCATCTCATCGAAAACACATTGGAAGCA
TAAATCCAAACTGCAATGTACTTGAAGTTATTAAAG
gtaaatactgacatttctccttgcaaaaaaagatacaaaaatcaaaattattgttatttc
ttactattaaaacatctatttgtatcatgagataaaatggtaggcacaaatgcatgggtt
tgaaaataaccttatagtattatttgtgcattatgtataggatgactattttattgatag

Exon  6 +      11051      11105   2   Internal     55    63    Marginal
agaaaatggggtgctctatgtttttttctacaagtttacagacatcttgctgttcagtac
atctggatatgctccaaggttttgaatggctctatggaatgtatcagtatgtgttaatta
attctcctgttcatgcacacttaggttgttttaatttttttctgttaccaccaataccag
CAGTACTGCTGTGAACATCCTTAAATACACGCTCACTTTTGCTAGTATTTTAGAG
gtgagattcctagaattaaaaacatttaaatgcatataaaattttggtatctccaaaaag
gtttcaaacaatggataagagtgtttcctaaccaactcttaagttttgttacatagatag
caattattttctccagcctgttatttttcttttttacattgttggtgtctttttagcata

Exon  7 +      11957      12034   1   Internal     78   100   Excellent
ggagaccatgtctctaccaaaaaaaaaaaaaaaaaaagcagactttcaccaaactatcaa
agtatattttcttctgtagagagttcaagactttgatttgtcaataccattgccatctta
atgcgtgaaagagaagtatatttattaaatccttttttgttttgttttgattcacactag
ATGGCTATGAAAATGCTAGGCGTCTGTGTGATTTGTATTATATTAACTCTCCCGAACTAG
AACTTGAAGAACTAAATG
gtaagcctgatgttgtctttttctcaataattagtgctttgattacttgataagggataa
gaatttaaatgttttaatggaagatgactttttatcaacttcgttggatatgaaggctaa
aggatagtaatcatgtaaaaaatatatctataaacatatgtaatttagtcagattcttta

Exon  8 +      12307      12360   0   Internal     54    77        Good
tatcaacttcgttggatatgaaggctaaaggatagtaatcatgtaaaaaatatatctata
aacatatgtaatttagtcagattctttatgaaaagatttggctttttgtatcacattttc
tttatttttaattgataactttgattctttgcttattttttattttctgtttagtcatag
AAAGAAAATGATACCAAGAAAGTTACATTTGACTTTTACATGCACTTCACTAAT
gtaagacttaccctttttctacttcctgagttgtaaataattttctgttgttgaggacat
agactggggttataaaagaggaaagaaagatgctcatctatttgagaatctgtttgtctc
tgatggttttctttttaccctgattagtgccttttggacaaaaagggtttagatgccttg

Exon  9 +      15845      15925   0    Initial     81    97   Excellent
gactccattaaaaaaaaaactttaaatgtggttataagaattgtgattctttggcatatt
tccatcaaattttaaaacttcaaatagtgcatatgtacttgaaaattacactttctcttt
tctaaaaagctgtatttttaatacaaccctaatgtatttcagaatgcaatgagagccact
ATGGAACACCATGCCAACAGAGGTGTTTACCCCCCTATTCAAGTTCATGTCACGCTGGGT
AATGAGGATTTGACTGTGAAG
gtaaatgtgtttaatggtttgttttcttttttttttttttgtaattgatgaacagacatg
caaaggtaaccatacgcataatttctaaaagacataatctactctcaggggaaaagaatc
ttgtctgtaatagataataagcacattgcttcattgagctggtggattatagttatccct

Exon 10 +      32407      32532   1   Internal    126    69    Marginal
tattctgatagttttgtgtccggaattggtgggtttttggtcttgctgacttcaagaatg
aagctgcggaccctcgcagtgttacagttcttaaagatggtgtatccagagttacttcag
atgttcagatgtgtctggagtttcttcctcccggtgagttcctggttttgctggcttcag
GAGTGAAGCTGCAGACCTTCACGGAGAGTGTTACAGCTCATAAAGGCAGGGCGTCTGGAG
TTGTTTGTTCCTCTCAGTGGGTTCGTGGTCTTGCTGGCTTCAGGAGTGAAGCTGCAGACC
TTTGTG
gtgagtgttgcagctcataaaggtggcacgtccagagttgtttgttcttctgggtgggtt
cgtggtctcggtggcttcaggagtgaagctgcagaccttcgcggtgagtgttacagctca
taaaggtagtgtggacccaaagagtgagcagcagcaagatttattgtgaagagcaaaaga

Exon 11 +      35410      35588   2   Internal    179    64    Marginal
tagagatatctccaggctcagaatgtggctggaaatttatgatattaagtcatgagatat
atctattaggctgcaacaagccattttctactcttgctcctaaaagagataacacatttt
atatgatattgccaagagcagtattgagataccatatccggaattggtttcttctggtag
GTTCTTGGTCTTGCTGACTTTGAGAATGAAGCTGCGGACCCTCATGGTGAGTGTTACAGT
TTTTAAAGATGGTGTGTCTGGAGTTTGTTCCTTCAGATGTTTAGATGTGTCCAGAGTTTC
TTTCTTCGGTGGGTTTGTGGTCTTGCTTGACCTCAGGAGTGAAGCCACAGACCTTCGCA
gtgagtgttacagctcttaaaggtggcatgtctggagttgtttgttcctcctggtgggtt
catggtctcgctgacttcaggagtgaagctgcagaccttcgtggtgagtgttacggctca
taaagatagtgcagacccaaagagtgagcagcagtaagatttattgtgaagagtgaaaga

Exon 12 +      35669      35745   1   Terminal     77    77        Good
ggagtttgttccttcagatgtttagatgtgtccagagtttctttcttcggtgggtttgtg
gtcttgcttgacctcaggagtgaagccacagaccttcgcagtgagtgttacagctcttaa
aggtggcatgtctggagttgtttgttcctcctggtgggttcatggtctcgctgacttcag
GAGTGAAGCTGCAGACCTTCGTGGTGAGTGTTACGGCTCATAAAGATAGTGCAGACCCAA
AGAGTGAGCAGCAGTAA
gatttattgtgaagagtgaaagaacaaagtttccgcagtgtggaaggggacccgagcggg
ttgccactgctggctggggtggccagcttttattcccttatttggccccacccatgtcct
gctgattggtccattttacagagtgctgattggtgtgtttacaaacctttagctagacac

Exon 13 +      37660      37796   0   Internal    137    77        Good
ctttctctctctctctgactccctctttgtccctgtctcttcctctctctgtctctgact
ttgtctctttctttctttctctctgactccctctttgtctctctcttcctctgtctctct
ctctgactttctgtctctttctctctttcctttctgctggtctttccctgcctctgccag
CTGCTTATGCTGCTCTTCTCCCCTCTCCTGGAGAAGTCCGCAGACCAAGAACCCACTGGA
AGGAACCAATTCCAGACACAATACGACCGAGCAGGCCAGCAAGGAAAAGCAATATGCTTT
TTCGAGACCAACCACAA
gtcattttatagaaagaataaagagttttaaatgaccagagggaagtcagctgatacagt
actcaagtaaacctcagcttaatcattgtcaatgcttaaatattaattatattaaatata
atgcatctctcagatgcgggctctgatagccccgtggtactcaatggcatctatcttaat

Exon 14 +      38036      38149   0   Internal    114   100   Excellent
tactcaagtaaacctcagcttaatcattgtcaatgcttaaatattaattatattaaatat
aatgcatctctcagatgcgggctctgatagccccgtggtactcaatggcatctatcttaa
ttagaaaagtatttcagtgtgtgtctttctgaatagaattttgtttttctcatcaaacag
GCTGGTTTTGGTTATGGATTGCCCATATCACGTCTTTACGCACAATACTTCCAAGGAGAC
CTGAAGCTGTATTCCCTAGAGGGTTACGGGACAGATGCAGTTATCTACATTAAG
gtaatagctgtagtcttcttgatttaatatttcttttgatgataagaacagatgtccata
cttaactgtaatgaaatttaactctaccacatgctgtttaaatagaaaaaaactatggtt
ttttgctggggatctcacccattttgatagatgatcccctaaaactatggggaaagagat

Exon 15 +      40930      41018   0   Internal     89    92   Excellent
taaataacacgtttcaaatatacataccatttaaaagtatatttaggtggtataaggatt
aataagatactaatagaatattatttaatttgtcgtaacctttttgccattgtctatttt
ctcaaataatgaattctaaaaaatgccagacttaataggtcttaggtttttctttttcag
GCTCTGTCAACAGACTCAATAGAAAGACTCCCAGTGTATAACAAAGCTGCCTGGAAGCAT
TACAACACCAACCACGAGGCTGATGACTG
gtgcgtccccagcagagaacccaaagacatgacgacgttccgcagtgcctagacacactt
gggacatcggaaaatccaaatgtggcttttgtattaaatttggaaggtatggtgttcaga
actatattataccaagtactttatttatcgttttcacaaaactatttgagtagaataaat

--------------------------------------------------------------------------------