--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (10345 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4496       4597   0    Initial    102   100   Excellent
agttgcctttgtgagaagctggaaatatttctttcaattccatctcttagttttccatgt
aagtattcagtttacatttatgttgcaggttaatcttaagaattgtattgctaaggcttc
taagtgaatttctccactctatttgcattttgttgcatttcagaggaacatcaagaaatc
ATGAACAACTTTGGTAATGAAGAGTTTGACTGCCACTTCCTCGATGAAGGTTTTACTGCC
AAGGACATTCTGGACCAGAAAATTAATGAAGTTTCTTCTTCT
gtaagtatatgaggcccatgctggcagtgcagctgagagtgccaggcaagtggaaaactt
tggcaaggtctaaggaagagcaatgaggcttacatgtcttgttatggaatgtagaaatta
attcactggtggtaaattaatagtgataatggtgatactcatatcagtggctagactcaa

Exon  2 +       4881       5054   0   Internal    174   100   Excellent
atggaatgtagaaattaattcactggtggtaaattaatagtgataatggtgatactcata
tcagtggctagactcaaaagagcaggattcattgtgactgatgggaatgaaggtcgctgg
ctattggtgtggtgtgtggtgaggctgctagtgagtcacctgtgaccactcttgtttcag
GATGATAAGGATGCCTTCTATGTGGCAGACCTGGGAGACATTCTAAAGAAACATCTGAGG
TGGTTAAAAGCTCTCCCTCGTGTCACCCCCTTTTATGCAGTCAAATGTAATGATAGCAAA
GCCATCGTGAAGACCCTTGCTGCTACCGGGACAGGATTTGACTGTGCTAGCAAG
gtaagcgatagcagcaggcctcaaaagcgttgtataaaatgggcctggtattccccacga
ggcagatacaagttgtgttttttgggcaataaatgctcactaaaggcaaatggggcgggg
gggtacatgacaacttcccatgcttttctgtttattccacgtgttaagccacatatggat

Exon  3 +       5261       5433   0   Internal    173   100   Excellent
gcgttgtataaaatgggcctggtattccccacgaggcagatacaagttgtgttttttggg
caataaatgctcactaaaggcaaatggggcgggggggtacatgacaacttcccatgcttt
tctgtttattccacgtgttaagccacatatggatagcatgacaccactcttctttttcag
ACTGAAATACAGTTGGTGCAGAGTCTGGGGGTGCCTCCAGAGAGGATTATCTATGCAAAT
CCTTGTAAACAAGTATCTCAAATTAAGTATGCTGCTAATAATGGAGTCCAGATGATGACT
TTTGATAGTGAAGTTGAGTTGATGAAAGTTGCCAGAGCACATCCCAAAGCAAA
gtgagttattcccccatctgagggcaagatcgggagcataagatatgtggattcttatca
aacaaacttaaatttctgattattatatttctatactttagtagaaagtagttgaaaccc
ccattgagtcatgaagcctgggactcaaactacagaatatatcagcgacagtatttagaa

Exon  4 +       5692       5826   2   Internal    135   100   Excellent
attattatatttctatactttagtagaaagtagttgaaacccccattgagtcatgaagcc
tgggactcaaactacagaatatatcagcgacagtatttagaacaggattgtttttatttt
aattgtggctataagtgaacatctatcatgagacatttgctgcactttccttgcttgtag
GTTGGTTTTGCGGATTGCCACTGATGATTCCAAAGCAGTCTGTCGTCTCAGTGTGAAATT
CGGTGCCACGCTCAGAACCAGCAGGCTCCTTTTGGAACGGGCGAAAGAGCTAAATATCGA
TGTTGTTGGTGTCAG
gtgagattttggtgggatagctagaggtcaagacattgaacagtttgagttttacaggct
ttctcctagtgtttgctattattttaagaaatactaagacacagtgtctcgtctctttat
tttaccccagcttccatgtaggaagcggctgtaccgatcctgagaccttcgtgcaggcaa

Exon  5 +       5957       6038   2   Internal     82   100   Excellent
ctccttttggaacgggcgaaagagctaaatatcgatgttgttggtgtcaggtgagatttt
ggtgggatagctagaggtcaagacattgaacagtttgagttttacaggctttctcctagt
gtttgctattattttaagaaatactaagacacagtgtctcgtctctttattttaccccag
CTTCCATGTAGGAAGCGGCTGTACCGATCCTGAGACCTTCGTGCAGGCAATCTCTGATGC
CCGCTGTGTTTTTGACATGGGG
gtgagtatacgtgaccctgttagggaagggcgggacacaactgacaataactagtcttaa
ttctagagttaactttttatggcagttggttctgtattacatgggtttcagcctatctgc
tgcatacatttttgttattagctgtggatctggctgacttattttcttgattctaggctg

Exon  6 +       6215       6298   0   Internal     84   100   Excellent
gggggtgagtatacgtgaccctgttagggaagggcgggacacaactgacaataactagtc
ttaattctagagttaactttttatggcagttggttctgtattacatgggtttcagcctat
ctgctgcatacatttttgttattagctgtggatctggctgacttattttcttgattctag
GCTGAGGTTGGTTTCAGCATGTATCTGCTTGATATTGGCGGTGGCTTTCCTGGATCTGAG
GATGTGAAACTTAAATTTGAAGAG
gtaatttagaacaaaactgtaatactcagtagccgttctaataaattcctttttggaata
tttcaaaatttaagtgtcttaactaataccacaatgggctgaagtgtcttggtgtgatat
tttgagtgatttctttgtgctgtctgacattacacttgataccatttggttttctaaagt

Exon  7 +       7354       7543   0   Internal    190   100   Excellent
gatatgtagcctggttttcagggagatgttgatgtttttttgcttttgttactttaatga
taaacctgtctgttgatgcctggtctcatgatgtcatgtcacaaggccctgtgatgttac
tcccccatgtgaatttcccacaatgaaggctgctctttcttttctgtttcactctcttag
ATCACCGGCGTAATCAACCCAGCGTTGGACAAATACTTTCCGTCAGACTCTGGAGTGAGA
ATCATAGCTGAGCCCGGCAGATACTATGTTGCATCAGCTTTCACGCTTGCAGTTAATATC
ATTGCCAAGAAAATTGTATTAAAGGAACAGACGGGCTCTGATGGTATGTATAAAGGACGA
ATCACTTCAT
gtataactgaaagctgatgcaaaaagtcattaagattgttgatctgcctttctagacgaa
gatgagtcgagtgagcagacctttatgtattatgtgaatgatggcgtctatggatcattt
aattgcatactctatgaccacgcacatgtaaagccccttctgcaaaaggtaatttctgag

Exon  8 +       7599       7711   1   Internal    113   100   Excellent
agctgagcccggcagatactatgttgcatcagctttcacgcttgcagttaatatcattgc
caagaaaattgtattaaaggaacagacgggctctgatggtatgtataaaggacgaatcac
ttcatgtataactgaaagctgatgcaaaaagtcattaagattgttgatctgcctttctag
ACGAAGATGAGTCGAGTGAGCAGACCTTTATGTATTATGTGAATGATGGCGTCTATGGAT
CATTTAATTGCATACTCTATGACCACGCACATGTAAAGCCCCTTCTGCAAAAG
gtaatttctgagcatactgtataaaacaattaagaggactggtcacaacacgtgtaatta
agtagtacttcctctctccgtctctttatatagagacctaaaccagatgagaagtattat
tcatccagcatatggggaccaacatgtgatggcctcgatcggattgttgagcgctgtgac

Exon  9 +       7805       8019   0   Internal    215   100   Excellent
tttatgtattatgtgaatgatggcgtctatggatcatttaattgcatactctatgaccac
gcacatgtaaagccccttctgcaaaaggtaatttctgagcatactgtataaaacaattaa
gaggactggtcacaacacgtgtaattaagtagtacttcctctctccgtctctttatatag
AGACCTAAACCAGATGAGAAGTATTATTCATCCAGCATATGGGGACCAACATGTGATGGC
CTCGATCGGATTGTTGAGCGCTGTGACCTGCCTGAAATGCATGTGGGTGATTGGATGCTC
TTTGAAAACATGGGCGCTTACACTGTTGCTGCTGCCTCTACGTTCAATGGCTTCCAGAGG
CCGACGATCTACTATGTGATGTCAGGGCCTGCGTG
gtaagtaagccatgcatgttgatggtgctgccaagaataggcaccttcttggatgtgtgc
ttcttgtctagacgaataagaaattgtcttgcctaagattaaatatatatggatattttt
cctaagaaaagttttagaaaagactgatgagtgtatttctatgtaattggaatatattta

Exon 10 +       8660       8804   2   Terminal    145    93   Excellent
ggaggttgaggctgcggtgagctatgatagcaccattgtattccagcctgagtaacagag
aaagaccctgtctcagaaaaaaaaaaaatacattgaattgtttcctgatgggaagtaaat
actctcatgcccagttaggagtgagtcagggtttttaatatgccactttttctttctcag
GCAACTCATGCAGCAATTCCAGAACCCCGACTTCCCACCCGAAGTAGAGGAACAGGATGC
CAGCACCCTGCCTGTGTCTTGTGCCTGGGAGAGTGGGATGAAACGCCACAGAGCAGCCTG
TGCTTCGGCTAGTATTAATGTGTAG
atagcactctggtagctgttaactgcaagtttagcttgaattaagggatttggggggacc
atgtaacttaattactgctagttttgaaatgtctttgtaagagtagggtcgccatgatgc
agccatatggaagactaggatatgggtcacacttatctgtgttcctatggaaactatttg

--------------------------------------------------------------------------------