--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (10649 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3258       3346   1   Internal     89    67    Marginal
ttcctgtgtctgtatttcagggaggagattggacaggctggactccccattgcttttcta
aaaatcttggaaactttgtccttcattgaattacgacactgtccacctttaatttcctcg
aaaacgcctgtaactcggctgaaggttagtgcaacttcatttctttcctttactctccag
AGCTCCCCAAACATCAAGAAACAGGACAAGGCAAACCCTGTAACTTAAGGTTTGCCCGAC
CCATCGCCTTCGGGAACAACTTTCTCATT
gtgaaattcaacttcatttctagatggtcatttctagaaagagactgctgaatctgagct
tcagagaagaggctcatctgagtgggatgagtgggggggtatgagggagatgtttggaaa
tacccaggagtgtagaccctcagtagctttttagctctgggtctttatttggttagtctt

Exon  2 +       4276       4566   0   Internal    291    89        Good
accccgggcttccaggtgcagcacagccccatgtgggacgacccgggatctctccacaac
ttccaccagaactacgtggccactacgcacatgatcgagcagaggaaaacgccagtctcc
cgcctctccctcttctcctttaagcaatcgccccctggcaccccggtgtctagttgccag
ATGCGCTTCGACGGGCCCCTGCACGTCCCCATGAACCCGGAGCCCGCCGGCAGCCACCAC
GTGGTGGACGGGCAGACCTTCGCTGTGCCCAACCCCATTCGCAAGCCCGCGTCCATGGGC
TTCCCGGGCCTGCAGATCGGCCACGCGTCTCAGCTGCTCGACACGCAGGTGCCCTCACCG
CCGTCGCGGGGCTCCCCCTCCAACGAGGGGCTGTGCGCTGTGTGTGGGGACAACGCGGCC
TGCCAACACTACGGCGTGCGCACCTGTGAGGGCTGCAAAGGCTTCTTTAAG
gtgagcaatggcgggagcggagtaggcaggtagggagcccctagtgcccgggacctcgga
gtgtgccctctgccttggtgccagtagcccagccccagctctcccgggactgcccagctc
tccggggtccgccgaagctgccctgcaggagaccatgggctgcggcggggacttccgggt

Exon  3 +       4715       4867   0   Internal    153    70        Good
gcacctgtgagggctgcaaaggcttctttaaggtgagcaatggcgggagcggagtaggca
ggtagggagcccctagtgcccgggacctcggagtgtgccctctgccttggtgccagtagc
ccagccccagctctcccgggactgcccagctctccggggtccgccgaagctgccctgcag
GAGACCATGGGCTGCGGCGGGGACTTCCGGGTGTCTGAGAAAGGGAAGCAGAAAGACTGG
GAGGCCAGGGTCGCATCCCCCTCGCATTCAGCCGACCCGGCTGGCCCCCGCCCGAAGTTG
CTGGAGCCGGAGTTGGAAGAGGGTCATTTGCAT
gtgctaggagctgtcttccctgttcagaatgaaattggttaggacagagaaccgtgtctg
agctaaccaagtggaacagaattccctatggtcaaattaagtgatctctttatttcgcca
tcctgattgaataatcttatcattttaaatagagaaggtctccaaggaatgtaaataata

Exon  4 +       5356       5485   0   Internal    130    81        Good
gggaggaaaaaagaaaagaaagaaagaaaaggaagagaaaaaaataaaatggaattgtgt
gtatgtgtttgtttgtggggaggaatcgtagaccccagtcacataacagaaattttctcc
gagttgcctgattttcaaaagaagaaaaaaaatgttggtctatattgtctccttttgcag
CGCACAGTGCAAAAAAATGCAAAATACGTGTGTTTAGCAAATAAAAACTGCCCAGTGGAC
AAGCGTCGCCGGAATCGCTGTCAGTACTGCCGATTTCAGAAGTGCCTGGCTGTTGGGATG
GTCAAAGAAG
gtaggctgaggggagctgccgaccctccagtttgcgcctttaggaaaccactgctcatac
tccagcatcacgttccacttcccggtgctggggatctccgactccccctcagtatggcct
ccaggaccctgcagctgcctgcttgcccggccttccctagagaaagccgccaggcccttc

Exon  5 +       6969       7171   0   Internal    203    95   Excellent
gacctcgtagcaccatccctaattgaattaattgccccggaacatctaatttccttactg
gtcagagagaggtttaattgttataaaaacctggctcccctattagaaacggggttagca
atttcacgggttatatattttagagaacctcattaagtgctttttaaaatgaaattccag
TTCCAGGCGAACCCTGACTATCAAATGAGTGGAGATGACACCCAGCATATCCAGCAATTC
TATGATCTCCTGACTGGCTCCATGGAGATCATCCGGGGCTGGGCAGAGAAGATCCCTGGC
TTCGCAGACCTGCCCAAAGCCGACCAAGACCTGCTTTTTGAATCAGCTTTCTTAGAACTG
TTTGTCCTTCGATTAGCATACAG
gtaataagggagggagggagacaatccagggaggctgtgagagaaatcaagaaaggaaaa
gaaagggaggaagggaaaccagagggtggggtagagaaaaagacagaataggaaatggaa
gtcggagaaaggaagaaaaagaaagaaaacaaaaaaagacgagaagaagcgagcccagaa

Exon  6 +       7286       7373   0    Initial     88    41    Marginal
agccgaccaagacctgctttttgaatcagctttcttagaactgtttgtccttcgattagc
atacaggtaataagggagggagggagacaatccagggaggctgtgagagaaatcaagaaa
ggaaaagaaagggaggaagggaaaccagagggtggggtagagaaaaagacagaataggaa
ATGGAAGTCGGAGAAAGGAAGAAAAAGAAAGAAAACAAAAAAAGACGAGAAGAAGCGAGC
CCAGAAGCCTTGGATGAATGGAATGGAG
gtgggatagggggcgttcttgattgttatgaaattaaaccctttcaaggtccactggtct
acattttattaactcttcagtaattaggtgactcttaaatccctcatttattgctcttca
agtaattagttgtttagcttttctctctctctttttctcccctctctctctttggtatta

Exon  7 +       7561       7739   2   Internal    179   100   Excellent
agggggcgttcttgattgttatgaaattaaaccctttcaaggtccactggtctacatttt
attaactcttcagtaattaggtgactcttaaatccctcatttattgctcttcaagtaatt
agttgtttagcttttctctctctctttttctcccctctctctctttggtattaattgcag
GTCCAACCCAGTGGAGGGTAAACTCATCTTTTGCAATGGGGTGGTCTTGCACAGGTTGCA
ATGCGTTCGTGGCTTTGGGGAATGGATTGATTCCATTGTTGAATTCTCCTCCAACTTGCA
GAATATGAACATCGACATTTCTGCCTTCTCCTGCATTGCTGCCCTGGCTATGGTCACAG
gtcagtactgcaggcgcagggcgcttcccctccagaactgcctagcaggatttgtcctga
gtttcccttgtcacagattctccttggttttgccaactagctaactgtcttgtacattct
tcttttgtttctgattatgttttctgcagagagacacgggctcaaggaacccaagagagt

Exon  8 +       7889       8145   1   Terminal    257    77        Good
tcctgcattgctgccctggctatggtcacaggtcagtactgcaggcgcagggcgcttccc
ctccagaactgcctagcaggatttgtcctgagtttcccttgtcacagattctccttggtt
ttgccaactagctaactgtcttgtacattcttcttttgtttctgattatgttttctgcag
AGAGACACGGGCTCAAGGAACCCAAGAGAGTGGAAGAACTGCAAAACAAGATTGTAAATT
GTCTCAAAGACCACGTGACTTTCAACAATGGGGGGTTGAACCGCCCCAATTATTTGTCCA
AACTGTTGGGGAAGCTCCCAGAACTTCGTACCCTTTGCACACAGGGGCTACAGCGCATTT
TCTACCTGAAATTGGAAGACTTGGTGCCACCGCCAGCAATAATTGACAAACTTTTCCTGG
ACACTTTACCTTTCTAA
gacctcctcccaagcacttcaaaggaactggaatgataatggaaactgtcaagagggggc
aagtcacatgggcagagatagccgtgtgagcagtctcagctcaagctgccccccatttct
gtaaccctcctagcccccttgatccctaaagaaaacaaacaaacaaacaaaaactgttgc

--------------------------------------------------------------------------------