--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (36778 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2792       2856   2   Internal     65    58    Marginal
tcaatttcttaacatgttccccctcttctgcaggggcagagagtggaacgcttgcgtttc
aaaacacttgctaatttctgtgaattgttataaaagtgaaaagaagtttctgctcatcct
ttgtagaaactttaaaagtagatatttatatttctaacttcttttgtaaatgaattttag
GAAAAAAATTGGAATTCAAGGAAATGTGTACTTGATGTACAGTAAATACGTTTATGCTGT
TAAAT
gtaaagttttcggttaattccaaagatctattgtaaagttttaagttatggacaatgtat
taattgtgcttttttccccctttaaagttgtttgtcttgaacttttccccagtcttcatt
gggattgtattcttctggttccaactagtgaagaattaaattgtaccttccgatttattt

Exon  2 +      12805      13019   0    Initial    215    40        Poor
tgatacatgacaatgctgtgacagtgcagatgagaaaatgtgacttctaactggggtgct
cagagaggatatcctggaggaactgccattttaactagacttttcttttaagcaggtaga
ttttgtttggttcaggcttcagctggaagcccaagcaatggtgcagatatgagctggact
ATGACAGACTATTGGGCCAGTGGGGCTGACAAGGTTAACTTGGGGGTTGCCATAGAGGGC
CTTCAGTGCTCATGTGCACTGTTTCAAGTTTGTACAGGGCATCTGGAAACCATGGAAGAA
GATTCTGGAAAGGGCAGGGCAGGTAAACTGGATGTGGATAGGAAGTTACTGTGGCAGGTG
AATTGGAAGATGGACAGGTTGGAGGCAGGGAGATG
gtgagcgggctcctgccaaggtgtaggtctgagcattgttgtgacggcttagttggtttg
acatcagcacacagattgaggatctgtcattgtaactctaaattgtatccttgttagaca
tgtaaaaataactttttagagcctccgtttttaaggagggaagtggattgtgctcaagct

Exon  3 +      31619      31885   0   Internal    267    95   Excellent
attcattgaatggaattaactgtgctcttctagaacattggatctgtgttctcatttaga
ttgtatttgtaatctccccacttcccaccatcaacagtggcataatgtgaattaatttat
gtggtatctgtcatttaaaaaacatgagctctctccttcctttttttgtcttaaacatag
GACATGGATTTGATTGACATACTTTGGAGGCAAGATATAGATCTTGGAGTAAGTCGAGAA
GTATTTGACTTCAGTCAGCGACGGAAAGAGTATGAGCTGGAAAAACAGAAAAAACTTGAA
AAGGAAAGACAAGAACAACTCCAAAAGGAGCAAGAGAAAGCCTTTTTCGCTCAGTTACAA
CTAGATGAAGAGACAGGTGAATTTCTCCCAATTCAGCCAGCCCAGCACATCCAGTCAGAA
ACCAGTGGATCTGCCAACTACTCCCAG
gtacagagtactcagttcttgggaaagttatggcaggtttaaggaaacactgagcaagga
attaaaatatctggatttgagttccagctttgcctttcttttacttaaccttgtcaaatc
tactttccaacctcagcctcctgatgagttcagtacctaacctgagttcagtacccaacc

Exon  4 +      32551      32640   0   Internal     90   100   Excellent
gctaagatctgaacccatgtggtctagttcaaattgtgcatcaaagtgatctctgaaata
agataaatatttacttaacttgattataaatattttatgaacatcaattattgaatattt
agcttggcaatggaatatttaaccatttttgttttcctttgtgtcattcccttttatcag
GTTGCCCACATTCCCAAATCAGATGCTTTGTACTTTGATGACTGCATGCAGCTTTTGGCG
CAGACATTCCCGTTTGTAGATGACAATGAG
gtgaggtataaaataacctggttaatagaaaaactccatcataactataaaataacaatc
tattctatgtaagtcccgtcaatgaatctccatttaaaagaataaaaacatttttaggag
gaaattttttaaccaaggaaatactcttgtcaaggaaaccttagcctataaataacttta

Exon  5 +      33307      33498   0   Internal    192    54    Marginal
aaatttgagtcagtggggtaggaaaaaaagatttgttatttacaaacggggtcatgactg
gttagtaagtagagagacacagaactgcagctgattccattttgttttgtagtggtgcct
tagagcttactcatcccctgttggtggaagactcataaatcaatgccttatcaattttag
GTTTCTTCGGCTACGTTTCAGTCACTTGTTCCTGATATTCCCGGTCACATCGAGAGCCCA
GTCTTCATTGCTACTAATCAGGCTCAGTCACCTGAAACTTCTGTTGCTCAGGTAGCCCCT
GTTGATTTAGACGGTATGCAACAGGACATTGAGCAAGTTTGGGAGGAGCTATTATCCATT
CCTGAGTTACAG
gtaactaaaatagaatgtaatactggagattttttttatattcagtgcctttagtcattc
tgattatttatataccacctatttataggaaggattggagggtgctattaacttagtcat
gagtactgcccatgctagttaaattggttggacatcttgaggatagaatgttataaacct

Exon  6 +      33882      35105   0   Terminal   1224    83        Good
aaataatacataacgcttaggcgtaaatatgtattggaaatgagaattatctctgaatta
tagataataaattatagagataagcctgaagataatgtgggtagggagtttatctaaatt
tatcacgtattatcatggattaactttgatttatatagtataaacttccttctcatgcag
TGTCTTAATATTGAAAATGACAAGCTGGTTGAGACTACCATGGTTCCAAGTCCAGAAGCC
AAACTGACAGAAGTTGACAATTATCATTTTTACTCATCTATACCCTCAATGGAAAAAGAA
GTAGGTAACTGTAGTCCACATTTTCTTAATGCTTTTGAGGATTCCTTCAGCAGCATCCTC
TCCACAGAAGACCCCAACCAGTTGACAGTGAACTCATTAAATTCAGATGCCACAGTCAAC
ACAGATTTTGGTGATGAATTTTATTCTGCTTTCATAGCTGAGCCCAGTATCAGCAACAGC
ATGCCCTCACCTGCTACTTTAAGCCATTCACTCTCTGAACTTCTAAATGGGCCCATTGAT
GTTTCTGATCTATCACTTTGCAAAGCTTTCAACCAAAACCACCCTGAAAGCACAGCAGAA
TTCAATGATTCTGACTCCGGCATTTCACTAAACACAAGTCCCAGTGTGGCATCACCAGAA
CACTCAGTGGAATCTTCCAGCTATGGAGACACACTACTTGGCCTCAGTGATTCTGAAGTG
GAAGAGCTAGATAGTGCCCCTGGAAGTGTCAAACAGAATGGTCCTAAAACACCAGTACAT
TCTTCTGGGGATATGGTACAACCCTTGTCACCATCTCAGGGGCAGAGCACTCACGTGCAT
GATGCCCAATGTGAGAACACACCAGAGAAAGAATTGCCTGTAAGTCCTGGTCATCGGAAA
ACCCCATTCACAAAAGACAAACATTCAAGCCGCTTGGAGGCTCATCTCACAAGAGATGAA
CTTAGGGCAAAAGCTCTCCATATCCCATTCCCTGTAGAAAAAATCATTAACCTCCCTGTT
GTTGACTTCAACGAAATGATGTCCAAAGAGCAGTTCAATGAAGCTCAACTTGCATTAATT
CGGGATATACGTAGGAGGGGTAAGAATAAAGTGGCTGCTCAGAATTGCAGAAAAAGAAAA
CTGGAAAATATAGTAGAACTAGAGCAAGATTTAGATCATTTGAAAGATGAAAAAGAAAAA
TTGCTCAAAGAAAAAGGAGAAAATGACAAAAGCCTTCACCTACTGAAAAAACAACTCAGC
ACCTTATATCTCGAAGTTTTCAGCATGCTACGTGATGAAGATGGAAAACCTTATTCTCCT
AGTGAATACTCCCTGCAGCAAACAAGAGATGGCAATGTTTTCCTTGTTCCCAAAAGTAAG
AAGCCAGATGTTAAGAAAAACTAG
atttaggaggatttgaccttttctgagctagtttttttgtactattatactaaaagctcc
tactgtgatgtgaaatgctcatactttataagtaattctatgcaaaatcatagccaaaac
tagtatagaaaataatacgaaactttaaaaagcattggagtgtcagtatgttgaatcagt

--------------------------------------------------------------------------------