--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (37196 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        644        752   0    Initial    109    44    Marginal
ttctcttaatttcgccaactcaatatataaaaggcctgttgaaaatggtgtacatcaaaa
taacctggagtgaaataagttgtctatttcagcaaagaaaatgggaaaataatagatgaa
acaactgtgttcctcttgataatcgttaagtctagcttgtcagtatttttactcttcggt
ATGTTTGAAAATTTTTATGCTAGACTCGAAAACCAGACTACCCTCTTACAAGACATTGTA
TCTGAGCAGGCTACCCTCTTACAAGACATTGTGCCCTTCTGTGTTGCAG
gtgtgtgggtcacttgagtaggcgtagatggtatggaggcaataaaaaaaccatggccca
gggctgagatatgcatgtgtgaccaaacgttagaatcagtatgaatccacaagtgtatgt
gaaatgcaggtcatttaagtgcttaatctaatgaaactcagagctttactggagttgggg

Exon  2 +       1248       1356   1   Internal    109    60    Marginal
gaccccttcagagctcctgcacgagcagccaaatccacccggccggtcctgccctctctc
cggcgctgcaggagccagctagccccgcccacgcccggccgccagtccaagccccgccct
cgggtcctaacgggaggcgcccgcggggctgtccgcggtcgcgccgggctccgcctgcag
TGTGGCCCGTCCGGACAGTCCCTCACCCCGGCCTGCGCTGCTGCGTGGACTCGGGCCTCA
GGAATTCCGCTGCGGCCCAAGGCTTGCCGTTTGACGAGGAGCAGTCGCG
gtaggcggtgggcaaggctgccctgggcggaggccgaggcgcggctcggactccagcatg
gcgaccgcggtgcgcgctgtgggctgcctccccgtgctgtgtagcgggacggcaggtgag
agctgggacgccgggagcaggggctctgagcgggccgggagtggggggctcgcctggggc

Exon  3 +       4678       4796   0    Initial    119    56    Marginal
gcccataaatgctgtgtcagagcctgttctggagtaccacactgtgtgagagggtacaca
gtacagtcagcgtggtgctgcagggattccagagggaagggggaacattgtaggatcagg
gaggcttcactaagaggtgatgtttcagacaaacagagaaccttgcagagacacagaagt
ATGCGAGAGCACAGTAGGTTCAAGACTGACTACAAGTCTGGCATGGCCAGAGGGAAGATG
GAGGAGAGAAAGGTGGGGCAGCAGGCTGGTGTGGAAGCTTGGGGCCATGTGGCAGGCCT
gtaggccatgctgaggagttttgactttgttctgaagatagtagggagtcagagaataat
ctatcagagctgtgaagtgaccagacctgttattttagaaaagccatgaagcagaggggg
agagattgaaattgggaaacctgctaggaaacttgttactctgtggctgagtggtgatga

Exon  4 +       7960       8116   2   Terminal    157    55    Marginal
cccccgttgtgcggatgaactataactttcccaactaggctgggcatttaggttgttatt
gatcaaaagttttatttttaaaagaaagactcctaaaaatctgattcttaaaagttcagg
attttagtgacttatttttgttagtaatgattatttgatgctagcagtgtttttccacag
CTGTGAAACATCTAACTCAAAGTTTAACCCATCTGCCTACAGGCCATTTGTCATCACTGG
GAACCAGAGACACCCATCCCTACGCCAGCTTGAGCCGTGCACTGCAGACACAATGCTGTA
TTTCTTCTCCCAGTCACCTGATGAGCCAGCAGTATAG
accatatagtttcttcactaaatgtatgtagaatggccacaaacttcctgtttcttgaaa
caggaaaaggatttcttatatctgaatttttcttcttttttacatgaattaagattttag
tgattagtttacaatgtactgttaaaatgaaaatgttccttgatgtacatcctagaatta

Exon  5 +      12829      12879   2   Internal     51    72        Good
ttctgggattacaggaatgagccactgtacctggccaacagttgattttataaccataga
ttgtgttccagatttgtgggttcagattgaaatgttgattcttgtttggactagaaaact
tatacttaggaaggatagttattagttatcttagtggttataatggaggcaagaggacag
GGAAGACGCCTATATCATGGTTGATAAAATGTCAGGGAAACGAACCTATTG
gtaagtaactgagatttgaatgctggcttttaagcagttagagggaaaaataaaatattt
agtgagagttttgtggaggaaagtaatagaattgtctcttcttgggctttccaagtgtaa
ccgtctgatgtgtgcaaaggatgatttaattttgctttcattacctcagtgatgcatggg

Exon  6 +      14797      14973   1   Internal    177    94   Excellent
taataccatgaagtatatttaaaattttgattgtgccaagtgacctaccaagttaataat
gttagcttaagctccagtgaacagtgtgtcatcattatctgtacatgcattgcctgacat
tttaacacttgaaaaatgagtactttaacaaaattattatttatatttttaaaccttcag
GGCGTTATGGTTTTCTATGGCCCGGACTGAATGTCCCTCTTATGAAAAATGGAGCAGTGC
AGACCATTGCCCAAAGAAGCAAGGAAGAGCAGGAGAAGGTGGAGGCAGACATGATCCAGC
AGAGAGAAGAGTGGGACCGAAAGAAGAAGATGAAGGTTAAACGGGAGCGAGGATGGA
gtggaaactcatggggaggcatcagtcttggcccccctgaccctggtccctgtggaggta
gcaaactcctggttttgtttgcctttgtgacagagagtacttgtagtttagaatttcctt
gaaatggtgttattacttgtctgtttatactacctttttccaaaaaagatttgaacatct

Exon  7 +      15726      15812   0    Initial     87    46    Marginal
ttgtcaatgagtgggagaagaggaaataggtaagagtttcgctgctttcttaagaagttt
ggcttaaagaggagggaagaggttgaaactggaggggagagattccaaagaacatgctta
gaactgatcaaaatgcttcagtcaggaggatgaaggtatggaagggagagaacaaaatcc
ATGAACCAAGTCCCTAATGACAGCCCAGATTCAGAGTGTGAAGTGGCTTCACTTGCTCAC
AGAAGGAAGGGCAGGGCACAGAATCAG
gtgagcctgtggggttgtagtggaaaggtaggtgggggtgttgtgtgatgtggccgcagt
tggtctgtaaggaagaggtggaatcatctgcggagagtgagatggggacattgatgatta
tggcctccagattatttctttacgaaaaggtagagtatctgaaactggcttcaaattatc

Exon  8 +      18493      18565   0    Initial     73    86        Good
ttggaaaaaggctgttacttgtgctcaggagttggaggatggtgtgcctgttctctgtgt
gtgcctgttcaccgtgtatgcctgcaaggaaggcggctccctccagttccctccttcaga
ttttcttaatgtgcaatatttatgagacattttgccttttaggtaagaaacgttttcact
ATGACTGCGAAAGAGGGAAGAAAGAAATCGATCCGTGTCTTGGTGGCTGTGGGGAACGGA
AAAGGAGCTGCAG
gtgaatggggagtgatggcatcacagtggcggtggtgtgcagggaaaggcgtggcacggg
ccatgctgtggagcccatgggctcatgctgctggccggactttttccattgattaaacct
tttagtggtttgggttcacaaagcttgtggtaagtccatgacttcccttagagagaaaag

Exon  9 +      21482      21528   1   Internal     47    52    Marginal
gagattacggatgtgaatcattacacccagcctattaatggttttgtatagcaagtcttt
tgtgggtggtggaaagatgaagtgctgtgaaatattgtaggagcagaaacttgaaatgtg
gcaaaaaccacatgggcaaaatttctgtctcttttcttatttttgcttttttgtttaaag
GTTTTTCTATTGGGAAAGCTACTGATCGGATGGATGCTTTCAGGAAA
gtatgtacattttttttctttgttgacactcagtaaaagattagtaagttatatgccaga
cacagtgggaaccacaaaacaataataatttgtcccagaaccttcccatgaggcttgctg
tcaagggttaattagctcataaaaatcagtttcagaagtacttatattcctttgcaccat

Exon 10 +      28865      28953   0   Internal     89    76        Good
tctgatgggcttccctttgtggataacccgacctttctctctggctgcccttgatatttt
ttccttcatttcaaccttggtgaatctgataattatgtgtcttggggttgctcttctcaa
ggagtatttttgtggtgttctctgtatttcctgaatttaaatgtttgcctgccttgctag
GTTGGGGAAGTTCTCTTGGATGATATCCTGAAGAGTGTTTTCGAACTTGGTTCCATTCTC
CCTGTCACTTCCAGGTACACCAATCAAAT
gtagatttggtcttttcacatagtcccatatttcttggaggttttgttcgtttttttact
cttttttctctaaacttctcttattgcttcatttcattaatttgatcttcaatcactgat
accctttcttccacttgattgaattggctactgaagcttatgcatgcatcacgtagttct

Exon 11 +      31657      31758   1   Internal    102    86        Good
agtagaaggaatagtttttgaccataaaaagtcaaactagaaagccattaatgtccaact
tccagagtagattttctgccttggagcagaagaggtgtgtgccgagttttatgtctggca
aataatgttagaggccaaacttgggccctgcagctccctcactccacctgcatttgccag
GTACTGCTCTGGGCTCTGGGGACACCGCGGTAAACAATATCCTGGCCCTCATGGGAGCCA
TCTTCTACTCAGGGGAAGCATTGGATAAACAGGTTTCGTTGA
gtgccctaatcagggtactgtgttagagtaggagggaggaaggcagaaggaaggatgcca
ccttgaatagcatggtcacagaaggcctgtctgaagaggagcaatttgagtgggaccttg
aaggtgagaaggagccaagggggcagagctgggaggacattccaggcagagggaatccca

Exon 12 +      31805      31881   2   Internal     77    57    Marginal
tgcagctccctcactccacctgcatttgccaggtactgctctgggctctggggacaccgc
ggtaaacaatatcctggccctcatgggagccatcttctactcaggggaagcattggataa
acaggtttcgttgagtgccctaatcagggtactgtgttagagtaggagggaggaaggcag
AAGGAAGGATGCCACCTTGAATAGCATGGTCACAGAAGGCCTGTCTGAAGAGGAGCAATT
TGAGTGGGACCTTGAAG
gtgagaaggagccaagggggcagagctgggaggacattccaggcagagggaatcccaagt
gcagtccttaaggtgaggaagccagcaggaggtggcgtgtctctagatgaggtcagggag
gtgggcgggcaggactcaggcacagaaggctctgaataggccatggtgctctttatatta

Exon 13 +      32573      32624   0    Initial     52    72        Good
attttcatgcatgtttattaatctcaataacaatcctgtttttttgccctcaaaatgtgt
tcaagatatttgtagatgtcatcttcttaatccttgtagtatcctgtttgagtaagtgtc
atcttggaagttaagtaagttgtcaagggtcagctcactaggaagtggtgataccagaat
ATGAACCAGTTTCCCGAAGCCCAGAGCCTGAAGCCATGCGAAAGCCAGCAGG
gtgactcctccggctgcaggcgagtgggctgtgtttcacccggtttctccttttctaggt
tacggcctccgctgccacagggccatcatcaccatctgccggctcattggcatcaaagac
atgtatgccaaggtctctgggtccattaatatgctcagcctcacccagggcctcttccgt

Exon 14 +      32683      32819   1   Internal    137   100   Excellent
agtaagtgtcatcttggaagttaagtaagttgtcaagggtcagctcactaggaagtggtg
ataccagaatatgaaccagtttcccgaagcccagagcctgaagccatgcgaaagccagca
gggtgactcctccggctgcaggcgagtgggctgtgtttcacccggtttctccttttctag
GTTACGGCCTCCGCTGCCACAGGGCCATCATCACCATCTGCCGGCTCATTGGCATCAAAG
ACATGTATGCCAAGGTCTCTGGGTCCATTAATATGCTCAGCCTCACCCAGGGCCTCTTCC
GTGGGCTCTCCAGACAG
gtaatcctttcccggggtctgaaacagaggttctagtttgtatttcagttgtgtgtgttg
gggctacgatgccctggggcctcctggagatgctttcctggggccacctgaggagttggg
cattctttgttgtctgtgactgcatcagtttagttaaatccattgacaagttcatgaaaa

Exon 15 +      35624      35848   0   Terminal    225   100   Excellent
ctgaaatgactccacccatgacaggttattagagtttagccacaaaacacattaacccaa
atccactgaaatggcctttgaatacccccaggctgtactgttgtggcctgtggaagttcc
tgctctttatgttgcaaatgtacttcagacctaacctgttctgaatttggtcttgcttag
GAAACCCATCAACAGCTGGCTGATAAGAAGGGCCTCCATGTTGTGGAAATCCGGGAGGAA
TGTGGCCCTCTGCCCATTGTGGTTGCGTCCCCCCGGGGGCCCTTGAGGAAGGATCCAGAG
CCAGAAGATGAGGTTCCAGACGTCAAACTGGACTGGGAAGATGTGAAGACTGCACAGGGA
ATGAAGCGCTCTGTGTGGTCTAATTTGAAGAGAGCCGCCACGTAA
cctctctggccttgtgcagccagttcctgtgctgccctgcacctaggagagactcagccc
ctcacagcttgggatgttaccttgccttttgtttgttttgagggaagtttaatctttaaa
ctctttggaaataaataattatagctttcatttgttgagcacatgttatatgccaatgtg

--------------------------------------------------------------------------------