--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (54886 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (17 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1333       1500   0     Single    168    53    Marginal
tccaatcctgatcatgtcaggaaacatcctgcaaattctgaaatcagagccaaagggaag
tgctgcgaggtttacaaccagctgcagtggttcgatgggaaggatctttctccaagtggt
tcctcttgaggggagcatttctgctggctccaggactttggccatctataaagcttggca
ATGAGAAATAAGAAAATTCTCAAGGAGGACGAGCTCTTGAGTGAGACCCAACAAGCTGCT
TTTCACCAAATTGCAATGGAGCCTTTCGAAATCAATGGTAAAGTACGATTCCCCAATAAT
GGAAATGACCAGAAATGTAGTCTTTCTGCTAGCGAGATACGAAAATAG
acaagtcaatagaaagtctaggtttggcttattgctgcattttgcacgtaatcatcacta
atactgtctggagtgcttcaatttggaatttctggaatgctaataatagatgctgtattt
ttagcatatagtcaggtttttcttagcttcactattgttttaatcatatttaaatatttt

Exon  2 +       8733       8835   0    Initial    103    80        Good
aagcctataggatcctttccagtgacttctgctcctaaaccacagaagtgccctacagtg
gggttagagttgctggtggtaggaatagtaatggatttaagcactgggttaggaaaggaa
aggaaaaagatagactaagctttccttagctttaatttggtagggcttgacccaggaaca
ATGGCCCATGATTCTGAGGATAATGGCACTTGCTTGACTCAGGTGTCATGTGTCCATCCC
TTTCCGCTGTACGAACAGCAGTCTCGATGGTTAGCAGCACAAG
gtacggtccttccaaggctggcccgagtttcccttctttctatcctttgatgagaatgtg
atccccaggctgatgctgatgtactggaaactccaagggcggcatctgtgctaaaagacc
ttttgtttcaagggaagagaaggtggaggataaaccaagtatataatttctaagaaattg

Exon  3 +      17132      17839   0     Single    708    47    Marginal
tgcagaaaaagcattcaataaaatccagcatccctttatgattaaaaccctcagtaaaat
cagcatacaagggatataccttaatgtaataaaggccatctatgacaaacccacagacaa
cataatactgaatggggaaaaattgaaagcattccctctgagaacgggaacaagataagg
ATGCTCACTCTCACCACTCCTCTTCAACATAGTGCTGAAAGTCCTAGCCAGAGCAATCAG
ACAAGATTAAAAAAAAAGGGCATCCAAATTGGTAAAGAGGAAATCAAACTGTCCCTTTTT
GCTGATGATATGACTGCTTACTTTGAAAACCTTAAGGGCTCCTCCAGAAAGCTCCTAGAA
CTGATAAAAGAATTCAGCAAAGTTTCTGGATACAAGATTAATGTATGCAAATCAATAGCT
CTTCCTTACACCAACAGTGACCAATCAGAGAATCAAATCAGGAACTCAATCACTTTTGCA
ATAGCTGCAAAAAAAAAAAAAAATACAATACTTAGGAAGATACCTAACAAAGGAGTCAAA
AGACCTCTTCAAAGAAAATTACAAAACACTGCTGAAAGAATCATAGATGACACAAACAAA
TGGAAACACATCCCATGCTCATGGATGGGTAGAAACAATAATGTGAAAATAATCGTACTG
CCAAAAGCAATCTACAAATTCGATGCAATCCCCATCAAAATACCACCATCATTCTTCACA
GAGTTAGAAAAAACAATTCTAAAATTCATATGGAACCAAAAAAGAGAAGGCATAGCCAAA
ACAAGACTAAGCAAAAAGAACAAATTTGGAGGCATCACACTATCTGATTTCAAACTATAC
TATAAGGCCACAGTCACCAAAACAGTGTGGTACCAGTATAAAAAATAG
cacatagaccaatggaaaagaacagagaacccagaaataaacccaaatacttaaagcaaa
caaaaatataaagtggggaaaggacacccttttcaacaaatggtgctgggataattggct
agccacatataggagaatgaaacttgatcctcctctctcaccttgtacaaaaatcaactc

Exon  4 +      18487      18565   0    Initial     79    50    Marginal
ctcaaacaaatcagtaagaaaaaaaattccatcaaaaagtgggctaaggatatgaaaaaa
caattctcaaaagaagatgtacaaatggccaagtgacatgtgaaaaaatgctcaacatca
ctaatgatcagggaaatgcaaatcaaaaccacagtgtgatactaccttactcctgcaaga
ATGGCCATAATAAAAAAAATCAAAAAAACCACAGATGTTGGCATGGATGTGGTGATCAGG
GAACACTTCTACACTGCTG
gtaggaatgtaaactaggacagctgctatggaaaacagtgtggagattccttaaagaagt
aaaagtagaaataccatttgatccagcaatcctactactgggtatctacccagaggaaaa
gaagtcactgtttgaaaaagatacttgcacatgcatgtttatagcagcacaattcacaat

Exon  5 +      21037      21082   2   Terminal     46    68    Marginal
tttcttccagggtttttatagttttgggttttacatttaagtctttaatccatcttgagt
taatttttgtataagatgtaagaaagggatccagtttcagttttctgcatatggctagcc
agttttcccagaaccatttattgaataggagatcctttccccattgcttgtttttgtcag
GTTTGTTGAAGATCAGATGCTCGTAGACGTGCGGTCTTATTGCTGA
gttgtctattctgttccattagtctatgtgtctgtttttgtaccagtactatgctgtttt
ggttactgtagacttgtagaatagtttgaagtctggtagtgtgatgcctccagctctgtt
ctttttgcttaggattttcttggatatacaagctcttttttggttctgtataattttgag

Exon  6 +      23556      23661   2   Internal    106    65    Marginal
tttactatatcatttcctttctgttaggggaacctcctctagtcattctttaaagttagt
tctgccagtaaaagattctcttcatttctcttcctctgagagtgtctttatttcttgtcc
attcccacagtgtatttttattggcaatataattcctggttgacaattcttctttttcag
AACACAAAATAAGCTGTACCACTTACATCTGTTCTCCATAGTTTCTGATGAGAAACTTTC
TGTCATTCAAATTGGTATTCCTGGCCAGGCACAGTGGCTCATGCCT
gtaatcccagcattttgggaggctgaggtgggcggatctcttgaggtcaggaattcaaga
ccagcctggacatcatagtgaaaccctgtctctactaaaaatataaaaattagccgggca
tggtggcgtgcacctgtaatcacaactacttgggaggctgaggcacaagaatcacctgaa

Exon  7 +      28162      28312   1   Internal    151    93   Excellent
ccacacagatgagtgaccaacagtggcaatttttgctttgtggcaagaaagaggattggg
ggatgatttgggagtcatgagcttttggtgtctttcccagctgacctcacagggtgcccc
ctgctcacatggagtagggcctggagcaggcagggacttcctgtgctgtgttctctgcag
CAGCCTCCTTCCTCCTGGCTTGTGTTTCAGTTCCAAAGCCCAAGAGGAGAAATGGGGTGA
ACTTCTCCCTAGCTGTGGTGGTCATCTACCTGATCCTGCTCACCGCTGGCGCTGGGCTGC
TGGTGGTCCAAGGTAAAGCAGGCTTGGTCCT
gtgtagtccctcctggggggagaggggtgacccagctgggcccctcagatgaagggctca
ggttgagtggagagcctcgggccactgctcccatctgctgggagacagtctcagcccctg
gcagccacagtgatgagaggagcaaagaaggagtgtatgttgtgtgtatgtgtgcctgag

Exon  8 +      29181      29370   0    Initial    190    62    Marginal
tgtgctcacgctaggtcctgacagcacatggaatttgtgtttacaaattcagggcctgta
gaagttatgcacacatgacacaagaatgtcagggatatgctcaaatgcctcagtccctaa
aagaatgctgtggggtggggcccagttctgaatctgcaggcgcggctccgggtcctggag
ATGTATTTCCTCAATGACACTCTGGCGGCTGAGGACAGCCCGTCCTTCTCCTTGCTGCAG
TCAGCACACCCTGGAGAACACCTGGCTCAGGGTGCATCGAGGCTGCAAGTCCTGCAGGCC
CAACTCACCTGGGTCCGCGTCAGCCATGAGCACTTGCTGCAGCGGGTAGACAACTTCACT
CAGAACCCAG
gtttggcctcctcccctctgggtcaggacttctcaacagaggtctgggagacagcgggat
caggaaccaggaaattaaggaccctgtccaagcaaagtgtgacctccaagagccagggac
ttagagcaaccagctcaatgccaagtctgaacccagagtccccacatggatccagaatgt

Exon  9 +      33246      33292   2   Internal     47    63    Marginal
catcttactgatgagggagctgaggctcaaaatgatgatgtaacttgcacaaggtcaccc
agctaaaggggcagtgctaacacctgctcctaggactgtgactcagtgtctctcttttgc
tttctaggccatgggtttcttgcaggaggagctctgtcttctttccttctttccacacag
TTGGCTCATCCCCATGCTCAGTGAACGTTTGTTGAATGAATCACCAT
gtaagtgattgcatggcgttgttgccccatcctgttgactgactcattagtgtctctgtt
cctcttcctcaggtcttcaaggtcacaagggggccatgggcatgcctggtgcccctggcc
cgccgggaccacctgctgagaagggagccaagggggctatgggacgagatggagcaacag

Exon 10 +      33365      33472   1   Internal    108    51    Marginal
ctttctaggccatgggtttcttgcaggaggagctctgtcttctttccttctttccacaca
gttggctcatccccatgctcagtgaacgtttgttgaatgaatcaccatgtaagtgattgc
atggcgttgttgccccatcctgttgactgactcattagtgtctctgttcctcttcctcag
GTCTTCAAGGTCACAAGGGGGCCATGGGCATGCCTGGTGCCCCTGGCCCGCCGGGACCAC
CTGCTGAGAAGGGAGCCAAGGGGGCTATGGGACGAGATGGAGCAACAG
gtacgggtctttttcttctgacccttaatcattttcctcctccttctctggcttcactct
gaattccctttcccttccaggcccctcgggaccccaaggcccaccgggagtcaagggaga
ggcgggtgagtaggtgctgggtatgtacccagaaatacacagcaagtttctcagagtgac

Exon 11 +      36860      36967   1   Internal    108    99   Excellent
cttctcttgagtcctgtcacatttcttcaagaccacccaagaaatgagctagcacatccc
ccagaggaaatctggggatcccattcccttctctcccaaatgcttcctgcccctttgcct
ctggtagcctgtccccaaaaggatagtgggagcccatctcaccagccattctctttgcag
GCACCCCAGGACCCCAAGGAGAGAAGGGCAGCAAAGGCGATGGGGGTCTCATTGGCCCAA
AAGGGGAAACTGGAACTAAGGGAGAGAAAGGAGACCTGGGTCTCCCAG
gtgagggccgtattgggggtgtcggtgcttgccaggaggcctgagggaactagggcctga
cctctgtgccattgggtctattcagtgcccactgagggcaaggcagtgctctgtctatgg
gaatctctggagcaccacacatagtctcttctttccgggtgagcaaagagatgcaatatg

Exon 12 +      38038      38361   0   Terminal    324    70        Good
tgatagctagtaatagtaatagtattagtaataataatagtagtagtagttatcctgtaa
cgtagaaagggaaggacttcagtttcaagatcagacagacctgggttctgatatggctca
ctaactgtgtgaccttgggcaaatgaattaacctctcttagcctcaatttactctcctag
AAAAGGGAGCTAATAATAATACAAACCTTTAATGAGGATGAATTACTGCAGGAATATAAG
ACATATGAGATGTGTACCACTGTACCTGGCACATGGGAATTCCTTACAAAAAAACTGGGA
AGCCTTGCCCTCAAGAAGACAGCCCTTAGTAGGGATGTGTCAGCCATCCTCAAATATTCA
AAGGGCATTTGTGGGAAAGAAAATGGTCTTGCCCAGGGTGGTACCCAGCAGAAGAACAAG
GACCAATGGACTAAGGTTTCAGGAGGACCAATTGTGCTAAGGCAAGGGAGGAAGAATGAT
TCAGAACCTGGGGCTGACCCATGA
tgaagtgcgtgggcatgggttttagcgggaagctgactgctgggaggggaggaggggctg
cagaattctcctaggctggtctgatgagggatactggcaccaggaacatggttgggtggt
tgacctctgaggatccttccaaagctggaacaacacagttctctttatagatgggaaagg

Exon 13 +      40441      40539   1   Internal     99    79        Good
tctggggcaaagcggtgcactccttgagggcagcggtcatatcttccactcgcgggcacc
aagtaggagctcaaggagtttagggtttgggatttcagtggaatgggaagtgtcagagga
ggacatggtggcctgattggagttcctcccacaactaaccaagactttttggtttttcag
GAAGCAAAGGGGACAGGGGCATGAAAGGAGATGCAGGGGTCATGGGGCCTCCTGGAGCCC
AGGGGAGTAAAGGTGACTTCGGGAGGCCAGGCCCACCAG
gtaagagggcacgtggtcacatccactgacctctaggtatttccttttttttttttttct
ggctggctgagccaaaggaaaaaaaaattcctaaaagttctttttcatcttaggtttggc
tggttttcctggagctaaaggagatcaaggtaagaactacaggaatctgggcatcatccc

Exon 14 +      40653      40688   0   Internal     36    94   Excellent
gcaggggtcatggggcctcctggagcccaggggagtaaaggtgacttcgggaggccaggc
ccaccaggtaagagggcacgtggtcacatccactgacctctaggtatttccttttttttt
tttttctggctggctgagccaaaggaaaaaaaaattcctaaaagttctttttcatcttag
GTTTGGCTGGTTTTCCTGGAGCTAAAGGAGATCAAG
gtaagaactacaggaatctgggcatcatcccagctacgactgtccctggcagagtgaagc
tggggaccagacaccaccatcttttgcttcattgtagtattcacccagaacacctggggt
tttttagacatctggccctggccaagaggaacagagcagccagtgggcggtgggggcagg

Exon 15 +      41188      41286   0   Internal     99   100   Excellent
attttcctcctactaagagggctagctcatggcttctaaagagaggtgttaaagctgcca
agaggactgtaaggtgttaagaggtacatgtctcactgctgaaaacagaagcactggggg
ttggggtatctgggccctctgccaaccaccacagcctggcagtcactactttcctttcag
GACAACCTGGACTGCAGGGTGTTCCGGGCCCTCCTGGTGCAGTGGGACACCCAGGTGCCA
AGGGTGAGCCTGGCAGTGCTGGCTCCCCTGGGCGAGCAG
gtgaggtcctgggtcctatggtgggcacagggagtgatgtgtgaaaacctgcctagtcca
gcccttatgctctctgtggtgtctgttgtccaggacttccagggagccccgggagtccag
gagccacaggcctgaaaggaagcaaaggggacacaggtaacagagggtgcagtgggtgag

Exon 16 +      49621      49665   0   Internal     45   100   Excellent
ttcatctgcagactgtctcttttcatgatctgctgaagaggctttaaacaatcgtggaga
accaatgtatctttccatctgcattaatcagacaaaaggtagaggttgtctaagattaaa
aatgtctaatacctaagttttattatctcctccccccccccttttttgttttgatcttag
GACTTCAAGGACAGCAAGGAAGAAAAGGAGAATCAGGAGTTCCAG
gtaaagggcaggctgcatcttcatccctcggagtgatgacggggaaggcctgccttctca
gagggcaggtcttgttgacattgaatgcacagctgtgaccttctcccaaagtggaggtta
agactccagggctctgtcactcaagcctcagatttctccgctgcaaaacctgggaaccac

Exon 17 +      52156      52340   1   Terminal    185   100   Excellent
aggctgcgtgccaggttgggttggcactgtaaagtgggatcttccaggctctggtgacag
tcaagcaggggcatttcttttccttaactgtagaactccaaaatgaaaagaaagagcccg
cacttacccaaagccccaaggggccttccttgcctctcccatgtgtgtttcttcacccag
GTGAAAACTCAGTGTCCGTCAGGATTGTCGGCAGTAGTAACCGAGGCCGGGCTGAAGTTT
ACTACAGTGGTACCTGGGGGACAATTTGCGATGACGAGTGGCAAAATTCTGATGCCATTG
TCTTCTGCCGCATGCTGGGTTACTCCAAAGGAAGGGCCCTGTACAAAGTGGGAGCTGGTA
AGTGA
gtcatcagccgggggcctcttccccagaggtgtggatgtggctttctctcgctggtgggg
tgttggcaagtgactcagtgtggttttctttaaaagaaaaatattggtccaagcaaccaa
aaagctctgcagtgcagggctccaggtatgcatccttccagcttggcaaccccagcagaa

--------------------------------------------------------------------------------